EMAGE mouse gene expression spatial database

Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:29925

Bcl2a1d B-cell leukemia/lymphoma 2 related protein A1d ( MGI:1278325)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


euxassay_004306_01	euxassay_004306_02	euxassay_004306_03	euxassay_004306_04	euxassay_004306_05

euxassay_004306_06	euxassay_004306_07	euxassay_004306_08	euxassay_004306_09	euxassay_004306_10

euxassay_004306_11	euxassay_004306_12	euxassay_004306_13	euxassay_004306_14	euxassay_004306_15

euxassay_004306_16	euxassay_004306_17	euxassay_004306_18	euxassay_004306_19	euxassay_004306_20

euxassay_004306_21	euxassay_004306_22

View assay images:
Expression pattern clarity:

Expression Pattern Description

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T8262
Entity Detected:	Bcl2a1d, B-cell leukemia/lymphoma 2 related protein A1d ( MGI:1278325)
Sequence:	sense strand is shown >T8262 CTTGGCCTCTAGGTGGGCAGCAGCAGTCAGCTCTGCCAGGGAAGATGTCTGAGTACGAGTTCATGTATAT CCACTCCCTGGCTGAGCACTACCTTCAGTATGTGCTACAGGTACCCGCCTTTGAGTCGGCTCCAAGCCAA GCATGCAGAGTGCTACAAAGAGTTGCTTTCTCCGTTCAGAAGGAAGTTGAAAAGAATCTGAAGTCATACT TGGATGACTTTCACGTGGAATCCATAGATACCGCCAGAATAATATTCAACCAAGTGATGGAAAAAGAGTT TGAAGATGGCATCATTAACTGGGGAAGGATTGTGACTATATTTGCCTTTGGGGGTGTTCTCCTCAAAAAA CTTCCACAAGAGCAGATTGCCCTGGATGTAGGTGCTTACAAACAAGTTTCCAGTTTTGTGGCAGAATTCA TAATGAATAACACAGGAGAATGGATACGGCGGAATGGAGGTTGGGAAGATGGCTTCATAAAGAAGTTTGA ACCCAAATCTGGCTGGCTGACTTTTCTGCAGATGACAGGACAGATCTGGGAAATGCTCTTTCTCCTCAAG TAACACTACGGACCAGAGAGAACCTTGGCTCCCACGAGAATGGTTATCAGCACTTGGCATTTCCATTTAC AAACATGAAACTTGTCTTTCCAGAGTTGCAGATATTTTGTTTCAACTTTAATGAATAAATTACTAGTATT TGTTTCTGTAAAAAAAAAAAAAAAAAAAAAA
Notes:	The probe template was PCR amplified from IMAGE:1363928 using vector (pT7T3D-PacI) specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:1363928 which was retrieved directly from NCBI.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Organism:	mouse
Strain:	C57BL/6
Age:	14.5 dpc
Theiler Stage:	TS23
Mutations:	none (wild-type)
Preparation:	section

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EurExpress:euxassay_004306 same experiment
	EMAGE:29923 same embryo
	EMAGE:32210 same embryo
	EMAGE:29535 same embryo
	EMAGE:30885 same embryo
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source