EMAGE mouse gene expression spatial database

Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:29936

Zfp764 zinc finger protein 764 ( MGI:2443580)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


euxassay_007826_01	euxassay_007826_02	euxassay_007826_03	euxassay_007826_04	euxassay_007826_05

euxassay_007826_06	euxassay_007826_07	euxassay_007826_08	euxassay_007826_09	euxassay_007826_10

euxassay_007826_11	euxassay_007826_12	euxassay_007826_13	euxassay_007826_14	euxassay_007826_15

euxassay_007826_16	euxassay_007826_17	euxassay_007826_18	euxassay_007826_19	euxassay_007826_20

euxassay_007826_21	euxassay_007826_22	euxassay_007826_23

View assay images:
Expression pattern clarity:

Expression Pattern Description

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T3134
Entity Detected:	Zfp764, zinc finger protein 764 ( MGI:2443580)
Sequence:	sense strand is shown >T3134 TGNCCTCGAGNCAGATTCGGCACGAGGCTTTTCCTGGCTCAGAAGTATTGATAGGCCTGAGGATGAAGAG AGCCTCGTTGAAGTCATTGTGTCTTTAATGCAGAGGCTAAAGTTGATGGCTCTGTGTGGGTTGAGCCAGC TGCATTCTCCGGGATTGAGTTACTGGTCAAGAGCCCGGTGTGGTGGTTCCTGCCTGTGATTCCCCCACTG GGGAGGTAGAGACAGGAAGATCAGAAATTTGAGACCAGTTTGGGTCACCTGAGACTGCATATAAACATAA ATGAATTTATTTATTTATTAATAACTGTAATTAATTACAGTTTAAAAACCAAAGTATCTATCACATGTAC CAAAGGCCCAAGTTTGTAGGTTCTCTGGAAAAAATCCAAAATATTCAGCCCAGCAAACAAGACAGAAGAG TTCTGTGGTCCATTCTCAGCACTCCATACACTGTGTGTGCTGGCACATGCTTGCTTGCAGCCCTTGGTAG CTGGTGGCACAAGGATGTTCAGAACTTTAAGGCTGCCCTCTGTCACAGACAGACAGACAGA
Notes:	The probe template was PCR amplified from IMAGE:1547673 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1547673 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Organism:	mouse
Strain:	C57BL/6
Age:	14.5 dpc
Theiler Stage:	TS23
Mutations:	none (wild-type)
Preparation:	section

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EurExpress:euxassay_007826 same experiment
	EMAGE:29839 same embryo
	EMAGE:29938 same embryo
	EMAGE:32191 same embryo
	EMAGE:29943 same embryo
	EMAGE:32214 same embryo
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source