Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30278

Krba1 KRAB-A domain containing 1 ( MGI:1925077)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30278 EMAGE:30278 EMAGE:30278 EMAGE:30278 EMAGE:30278
euxassay_000492_01 euxassay_000492_02 euxassay_000492_03 euxassay_000492_04 euxassay_000492_05
EMAGE:30278 EMAGE:30278 EMAGE:30278 EMAGE:30278 EMAGE:30278
euxassay_000492_06 euxassay_000492_07 euxassay_000492_08 euxassay_000492_09 euxassay_000492_10
EMAGE:30278 EMAGE:30278 EMAGE:30278 EMAGE:30278 EMAGE:30278
euxassay_000492_11 euxassay_000492_12 euxassay_000492_13 euxassay_000492_14 euxassay_000492_15
EMAGE:30278 EMAGE:30278 EMAGE:30278 EMAGE:30278 EMAGE:30278
euxassay_000492_16 euxassay_000492_17 euxassay_000492_18 euxassay_000492_19 euxassay_000492_20
EMAGE:30278 EMAGE:30278 EMAGE:30278
euxassay_000492_21 euxassay_000492_22 euxassay_000492_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2150
Entity Detected:Krba1, KRAB-A domain containing 1 ( MGI:1925077)
Sequence:sense strand is shown

>T2150
TGGCCTCGAGGCCAGATTCGGCACGAGGGCCACGACAGAGGCATTCCTCAGCTGTACCTCTGACTTTCTT
GGCTCAGGTTCAGTCAGTTGCTCTTCCTCCTTGGCAAAGCCATCTAGGTTCCAGGTGGGTGTCATGCATA
CCACATGTGCACAGAGCCAGCTGCAGAGGGCACCACAAGGGCACCTTAACCAGCTCCTGATCTCAAGAAC
ACTAAAAGGCTAGCCGTTGTCTGTCTAGAGTGAATACTTCACAGATCTCATTTAGGGAGAGCCTGGTCTA
TGGACTAAGCTGAATTTTCCCACATAGATTCTAAAATTAAATGTATTAGTTGCTAAGTAAAAAAAAAAAA
AAA
Notes:The probe template was PCR amplified from IMAGE:875348 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:875348 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000492 same experiment
 EMAGE:31309 same embryo
 EMAGE:30296 same embryo
 EMAGE:31221 same embryo
 EMAGE:31236 same embryo
 EMAGE:30279 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS