Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30313

Gp6 ( MGI:1889810)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30313 EMAGE:30313 EMAGE:30313 EMAGE:30313 EMAGE:30313
euxassay_016809_01 euxassay_016809_02 euxassay_016809_03 euxassay_016809_04 euxassay_016809_05
EMAGE:30313 EMAGE:30313 EMAGE:30313 EMAGE:30313 EMAGE:30313
euxassay_016809_06 euxassay_016809_07 euxassay_016809_08 euxassay_016809_09 euxassay_016809_10
EMAGE:30313 EMAGE:30313 EMAGE:30313 EMAGE:30313 EMAGE:30313
euxassay_016809_11 euxassay_016809_12 euxassay_016809_13 euxassay_016809_14 euxassay_016809_15
EMAGE:30313 EMAGE:30313 EMAGE:30313 EMAGE:30313 EMAGE:30313
euxassay_016809_16 euxassay_016809_17 euxassay_016809_18 euxassay_016809_19 euxassay_016809_20
EMAGE:30313 EMAGE:30313 EMAGE:30313 EMAGE:30313
euxassay_016809_21 euxassay_016809_22 euxassay_016809_23 euxassay_016809_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Detection Reagent
Type:in situ hybridisation probe
Identifier:T63485
Entity Detected:Gp6, ( MGI:1889810)
Sequence:sense strand is shown

>T63485
TTCTTCTGTATTGGGCTGTGTGTACTGCAAGTGATCCAAACACAGAGTGGCCCACTCCCCAAGCCTTCCC
TCCAGGCTCAGCCCAGTTCCCTGGTACCCCTGGGTCAGTCAGTTATTCTGAGGTGCCAGGGACCTCCAGA
TGTGGATTTATATCGCCTGGAGAAACTGAAACCGGAGAAGTATGAAGATCAAGACTTTCTCTTCATTCCA
ACCATGGAAAGAAGTAATGCTGGACGGTATCGATGCTCTTATC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 108827. Forward Primer - name:108827_F_cDNA_LOC434265, sequence:TTCTTCTGTATTGGGCTGTGTG; Reverse Primer - name:108827_N_SP6_cDNA_LOC434265, sequence:GATAAGAGCATCGATACCGTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_016809 same experiment
 EMAGE:30292 same embryo
 EMAGE:30294 same embryo
 EMAGE:30311 same embryo
 EMAGE:30315 same embryo
 EMAGE:30314 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS