Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30367

Nusap1 nucleolar and spindle associated protein 1 ( MGI:2675669)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30367 EMAGE:30367 EMAGE:30367 EMAGE:30367 EMAGE:30367
euxassay_017757_01 euxassay_017757_02 euxassay_017757_03 euxassay_017757_04 euxassay_017757_05
EMAGE:30367 EMAGE:30367 EMAGE:30367 EMAGE:30367 EMAGE:30367
euxassay_017757_06 euxassay_017757_07 euxassay_017757_08 euxassay_017757_09 euxassay_017757_10
EMAGE:30367 EMAGE:30367 EMAGE:30367 EMAGE:30367 EMAGE:30367
euxassay_017757_11 euxassay_017757_12 euxassay_017757_13 euxassay_017757_14 euxassay_017757_15
EMAGE:30367 EMAGE:30367 EMAGE:30367 EMAGE:30367 EMAGE:30367
euxassay_017757_16 euxassay_017757_17 euxassay_017757_18 euxassay_017757_19 euxassay_017757_20
EMAGE:30367 EMAGE:30367 EMAGE:30367 EMAGE:30367
euxassay_017757_21 euxassay_017757_22 euxassay_017757_23 euxassay_017757_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1548
Entity Detected:Nusap1, nucleolar and spindle associated protein 1 ( MGI:2675669)
Sequence:sense strand is shown

>T1548
GTCTTATTGAAATCTTATTTTACCTTGATAAAATAAGATTTCAATAAGACTAATAGATTTTCCAGGCTAC
TGAAATCTTATTTTATCAAGGTAAAAAGTTTTAGCTTATAAGAGCCTTGTTCTGACTTTTCATGTATTTG
CCATCTGTCATTCATTATAATCCTAAACGAGAAAACCTCTACTCTCTCTACTTGTTAAATAAAAGCCACA
GGGCAAAGGGTGTGCTTTAGTTGTACAACACTTATCTATCACACTCCTGTCCCTGAACTGTACCACCAAA
ACCAAAGCTGAGAATTGCTGCTGTAAGAATTACTGTCATTGGCAGACTTTTTTCTTACAAGTAGTAAAGA
GAGGAAAGCTGCAAGGGGTGACCTTCTGATCTTTGCTCTGCCTTACAGAGATTCTGAGATGTGTGTAATG
CTTACAATGTTCATAAATAAAATTTTTCACTGTGAAA
Notes:The probe template was PCR amplified from IMAGE:865545 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:865545 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_017757 same experiment
 EMAGE:30354 same embryo
 EMAGE:29479 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS