EMAGE mouse gene expression spatial database

Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30455

9130210N20Rik ( MGI:2442664)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


euxassay_001925_01	euxassay_001925_02	euxassay_001925_03	euxassay_001925_04	euxassay_001925_05

euxassay_001925_06	euxassay_001925_07	euxassay_001925_08	euxassay_001925_09	euxassay_001925_10

euxassay_001925_11	euxassay_001925_12	euxassay_001925_13	euxassay_001925_14	euxassay_001925_15

euxassay_001925_16	euxassay_001925_17	euxassay_001925_18	euxassay_001925_19	euxassay_001925_20

euxassay_001925_21	euxassay_001925_22	euxassay_001925_23	euxassay_001925_24

View assay images:
Expression pattern clarity:

Expression Pattern Description

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T618
Entity Detected:	9130210N20Rik, ( MGI:2442664)
Sequence:	sense strand is shown >T618 CCTCNAGNCTGTTGGCCTACTGGAAGAACATTCTGAGGGGCAAGCGGCTAGTTGGAGTCCAGGAGACTGG GATGGGGGTGTGCCAGTCGCCTATCTTGCTGGTTTGAGTCCCTGCAACTACTAGCAGATTAGGCGGCTCG CTCCGCCCACTTCTGCCGGGAAAGGCCCTCCTTTCGTGTGAGTTGGTTCTCTGGACCAGTGCCGTAGGGG GTGGAGTAGGGCGCCATTAGTCGGGAGCCTGTGTACCCCGCGGAATGGAGATGGAGCTGGACAGCGAGGG GCGCATGGTGGTGCGGCCGCTGCTCACCGACCTCTATCAGGCTACCATGGCGCTGGGCTACTGGCGTGCG GGCCGGGCGTGCGAGGCAGCAGAGTTCGAGCTCTTCTTCCGCCACTGCCCTTTCGGAGGCTCCTTCGCCC TTTCCGCTGGCTTGCAGGACTGTATGCGCTTTCTTCGCGCCTTCCGTCTGCGGGATGCAGATGTGCAGTT CCTGGCTTCGGTACTACCCCCAGACACTGACCCTGCGTTCTTCGAGCACCTTCG
Notes:	The probe template was PCR amplified from IMAGE:1886129 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1886129 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Organism:	mouse
Strain:	C57BL/6
Age:	14.5 dpc
Theiler Stage:	TS23
Mutations:	none (wild-type)
Preparation:	section

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EurExpress:euxassay_001925 same experiment
	EMAGE:29659 same embryo
	EMAGE:31487 same embryo
	EMAGE:31569 same embryo
	EMAGE:30402 same embryo
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source