Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30556

Gm939 ( MGI:2685785)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30556 EMAGE:30556 EMAGE:30556 EMAGE:30556 EMAGE:30556
euxassay_001977_01 euxassay_001977_02 euxassay_001977_03 euxassay_001977_04 euxassay_001977_05
EMAGE:30556 EMAGE:30556 EMAGE:30556 EMAGE:30556 EMAGE:30556
euxassay_001977_06 euxassay_001977_07 euxassay_001977_08 euxassay_001977_09 euxassay_001977_10
EMAGE:30556 EMAGE:30556 EMAGE:30556 EMAGE:30556 EMAGE:30556
euxassay_001977_11 euxassay_001977_12 euxassay_001977_13 euxassay_001977_14 euxassay_001977_15
EMAGE:30556 EMAGE:30556 EMAGE:30556 EMAGE:30556 EMAGE:30556
euxassay_001977_16 euxassay_001977_17 euxassay_001977_18 euxassay_001977_19 euxassay_001977_20
EMAGE:30556 EMAGE:30556 EMAGE:30556 EMAGE:30556 EMAGE:30556
euxassay_001977_21 euxassay_001977_22 euxassay_001977_23 euxassay_001977_24 euxassay_001977_25

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3985
Entity Detected:Gm939, ( MGI:2685785)
Sequence:sense strand is shown

>T3985
CTGGCTTTCGGACTCTCCTGCAGCAGCTTCCTCCACAGGACAGTGATGAACGCTACTGTCTGGCCCTAGG
GGAGGAGGAACTGGCCCAACTTCGACTCTTCTGTGCCCAGCGGAACACGAAATCCCTGGGACAGGGGGTG
GCCCGTCTACTGCCTCCTAAGCTTGAAGGATACACCTGTAAGAAGTGCAAGAAGCTACTGGATCCAGGGG
AGTATGGAGTGTTCGCGGCCAGGGCTGGTGAGCAGAGCTGCTGGCACAGACCCTGCTTTGCTTGCCAGGC
CTGTGGCAAGGGCCTCATAAACCTCATCTACTTCTACCACGAGGGGCACCTGTACTGTGGCCGTCATCAT
GCGGAGCTCTTACGACCTCGATGTCCAGCTTGTGACCAGTTCGAGCAGAGGTCCTTAAATTAGTTTG
Notes:The probe template was PCR amplified from IMAGE:443852 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:443852 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_001977 same experiment
 EMAGE:30291 same embryo
 EMAGE:30586 same embryo
 EMAGE:30566 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS