Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30602

Rnf7 ring finger protein 7 ( MGI:1337096)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30602 EMAGE:30602 EMAGE:30602 EMAGE:30602 EMAGE:30602
euxassay_017054_01 euxassay_017054_02 euxassay_017054_03 euxassay_017054_04 euxassay_017054_05
EMAGE:30602 EMAGE:30602 EMAGE:30602 EMAGE:30602 EMAGE:30602
euxassay_017054_06 euxassay_017054_07 euxassay_017054_08 euxassay_017054_09 euxassay_017054_10
EMAGE:30602 EMAGE:30602 EMAGE:30602 EMAGE:30602 EMAGE:30602
euxassay_017054_11 euxassay_017054_12 euxassay_017054_13 euxassay_017054_14 euxassay_017054_15
EMAGE:30602 EMAGE:30602 EMAGE:30602 EMAGE:30602 EMAGE:30602
euxassay_017054_16 euxassay_017054_17 euxassay_017054_18 euxassay_017054_19 euxassay_017054_20
EMAGE:30602
euxassay_017054_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Detection Reagent
Type:in situ hybridisation probe
Identifier:T45168
Entity Detected:Rnf7, ring finger protein 7 ( MGI:1337096)
Sequence:sense strand is shown

>T45168
GCGACAAGATGTTCTCTCTCAAGAAGTGGAACGCGGTAGCCATGTGGAGCTGGGACGTTGAGTGCGATAC
CTGTGCCATCTGCAGGGTCCAGGTGATGGATGCCTGCCTTCGATGTCAAGCTGAAAACAAGCAAGAGGAC
TGTGTTGTGGTCTGGGGAGAGTGTAACCATTCCTTCCACAACTGCTGCATGTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from genomic DNA prepared from tail-tips of two wild-type C57BL/6J mice), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 204192204192. Forward Primer - name:204192_F_exon_Rnf7, sequence:GCGACAAGATGTTCTCTCTCAA; Reverse Primer - name:204192_N_SP6_exon_Rnf7, sequence:GACATGCAGCAGTTGTGGAAG.The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_017054 same experiment
 EMAGE:30605 same embryo
 EMAGE:30604 same embryo
 EMAGE:30404 same embryo
 EMAGE:30609 same embryo
 EMAGE:30607 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS