Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30723

Hoxa11 homeobox A11 ( MGI:96172)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30723 EMAGE:30723 EMAGE:30723 EMAGE:30723 EMAGE:30723
euxassay_003285_01 euxassay_003285_02 euxassay_003285_03 euxassay_003285_04 euxassay_003285_05
EMAGE:30723 EMAGE:30723 EMAGE:30723 EMAGE:30723 EMAGE:30723
euxassay_003285_06 euxassay_003285_07 euxassay_003285_08 euxassay_003285_09 euxassay_003285_10
EMAGE:30723 EMAGE:30723 EMAGE:30723 EMAGE:30723 EMAGE:30723
euxassay_003285_11 euxassay_003285_12 euxassay_003285_13 euxassay_003285_14 euxassay_003285_15
EMAGE:30723 EMAGE:30723 EMAGE:30723 EMAGE:30723 EMAGE:30723
euxassay_003285_16 euxassay_003285_17 euxassay_003285_18 euxassay_003285_19 euxassay_003285_20
EMAGE:30723 EMAGE:30723 EMAGE:30723 EMAGE:30723
euxassay_003285_21 euxassay_003285_22 euxassay_003285_23 euxassay_003285_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3881
Entity Detected:Hoxa11, homeobox A11 ( MGI:96172)
Sequence:sense strand is shown

>T3881
AGAATCATGTTAAGCTCGGCTACTGCGGAGAACCCAAGGTAGCCCAATGATGGATTTTGATGAGCGTGGT
CCCTGCTCCTCTAACATGTATTTGCCAAGTTGTACTTACTACGTCTCGGGTCCAGATTTCTCCAGCCTCC
CTTCTTTGTGGCCCCAGACCCCGTCTTCGCGCCCAATGACATACTCCTACTCCTCCAAGCTGCCCCAGGT
CCAACCCGTGCGCGAAGTGACCTTCAGAGAGTACGCCATTGAGCCCGCCACTAAATGGCACCCCCGCGGC
AATCTAGGCCACTACTACTCCGCGGAGGAGCTCGTGCACAGAGACTGTCTGCAGGCGCCCAGCGCGCCGA
GGTGACTGGCGACGTGATGGCCGAGAGCTCGGCAACGTCTA
Notes:The probe template was PCR amplified from IMAGE:552983 using vector specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:552983 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_003285 same experiment
 EMAGE:29725 same embryo
 EMAGE:31801 same embryo
 EMAGE:31724 same embryo
 EMAGE:29662 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS