Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30761

Snrpd3 ( MGI:1914582)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30761 EMAGE:30761 EMAGE:30761 EMAGE:30761 EMAGE:30761
euxassay_012187_01 euxassay_012187_02 euxassay_012187_03 euxassay_012187_04 euxassay_012187_05
EMAGE:30761 EMAGE:30761 EMAGE:30761 EMAGE:30761 EMAGE:30761
euxassay_012187_06 euxassay_012187_07 euxassay_012187_08 euxassay_012187_09 euxassay_012187_10
EMAGE:30761 EMAGE:30761 EMAGE:30761 EMAGE:30761 EMAGE:30761
euxassay_012187_11 euxassay_012187_12 euxassay_012187_13 euxassay_012187_14 euxassay_012187_15
EMAGE:30761 EMAGE:30761 EMAGE:30761 EMAGE:30761 EMAGE:30761
euxassay_012187_16 euxassay_012187_17 euxassay_012187_18 euxassay_012187_19 euxassay_012187_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37064
Entity Detected:Snrpd3, ( MGI:1914582)
Sequence:sense strand is shown

>T37064
AGATGTCTATTGGTGTGCCGATTAAAGTCTTGCACGAGGCTGAAGGCCACATAGTGACGTGTGAGACCAA
CACCGGGGAAGTATACCGAGGGAAGCTCATTGAAGCAGAGGACAACATGAACTGTCAGATGTCCAACATC
ACAGTCACATACAGAGATGGTCGAGTGGCACAGCTGGAACAGGTATATATACGTGGCAGCAAGATCCGAT
TTCTGATTTTGCCTGACATGCTGAAAAATGCACCCATGTTAAAGAGCATGAAAAATAAAAACCAAGGCTC
AGGGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 89176. Forward Primer - name:089176_F_cDNA_Snrpd3, sequence:AGATGTCTATTGGTGTGCCGAT; Reverse Primer - name:089176_N_SP6_cDNA_Snrpd3, sequence:CCCCTGAGCCTTGGTTTTTA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_012187 same experiment
 EMAGE:32183 same embryo
 EMAGE:30634 same embryo
 EMAGE:31756 same embryo
 EMAGE:30786 same embryo
 EMAGE:32224 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS