Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30797

Stac2 SH3 and cysteine rich domain 2 ( MGI:2144518)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30797 EMAGE:30797 EMAGE:30797 EMAGE:30797 EMAGE:30797
euxassay_002906_01 euxassay_002906_02 euxassay_002906_03 euxassay_002906_04 euxassay_002906_05
EMAGE:30797 EMAGE:30797 EMAGE:30797 EMAGE:30797 EMAGE:30797
euxassay_002906_06 euxassay_002906_07 euxassay_002906_08 euxassay_002906_09 euxassay_002906_10
EMAGE:30797 EMAGE:30797 EMAGE:30797 EMAGE:30797 EMAGE:30797
euxassay_002906_11 euxassay_002906_12 euxassay_002906_13 euxassay_002906_14 euxassay_002906_15
EMAGE:30797 EMAGE:30797 EMAGE:30797 EMAGE:30797 EMAGE:30797
euxassay_002906_16 euxassay_002906_17 euxassay_002906_18 euxassay_002906_19 euxassay_002906_20
EMAGE:30797 EMAGE:30797 EMAGE:30797 EMAGE:30797
euxassay_002906_21 euxassay_002906_22 euxassay_002906_23 euxassay_002906_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
kidney calyx
moderate moderate
regionalmoderate expression: see section 10 11 12 19 20 21
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T299
Entity Detected:Stac2, SH3 and cysteine rich domain 2 ( MGI:2144518)
Sequence:sense strand is shown

>T299
CTATGGGAGAGCCCTAAGTTAACCACCTGTCACCCCTTCAACTCTCAGGAAAGTTCAGGAATCTTTCCAA
TTACTTGAAACCTGGGCGACAGAGCAGGGTCAGGACTGAGGTCTGCAAGGGATTGTAACACGTAGGAGTC
TGTTCCTTGAAGGCAGTCCTCACAGAACAGTCTCATTCTCCTTTGTCTACTAGAAATCGGTAGCCAAGAG
CAGCCTGGACAAAGACCCAGGTGGAGAACAAGACGCTGGCCCTTGCTTGGTCAAAACATTTCACTGTTAG
GACTCCAGAAATCCCTACCACCAGAAGCAGACAGCTAGGGGAGTCTGAGGTTGTGAGGTCTGGTTTCTCT
AAAAGCCCTGTCCTCAGATGGACCAAACTTACCTTCTTACCGTTTGGGCTCTATAGGGCCCATCCCTGGG
AAGGATACCTTGGCAGATTGAGGAAGGCTATGGAAAGTTCTTTTGGCCACCATCAAATGATGCTCTAGGA
GCCCTTAGCCCTCCTG
Notes:The probe template was PCR amplified from IMAGE:2811509 using vector specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2811509 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002906 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS