Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30818

Fgfrl1 ( MGI:2150920)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30818 EMAGE:30818 EMAGE:30818 EMAGE:30818 EMAGE:30818
euxassay_008201_01 euxassay_008201_02 euxassay_008201_03 euxassay_008201_04 euxassay_008201_05
EMAGE:30818 EMAGE:30818 EMAGE:30818 EMAGE:30818 EMAGE:30818
euxassay_008201_06 euxassay_008201_07 euxassay_008201_08 euxassay_008201_09 euxassay_008201_10
EMAGE:30818 EMAGE:30818 EMAGE:30818 EMAGE:30818 EMAGE:30818
euxassay_008201_11 euxassay_008201_12 euxassay_008201_13 euxassay_008201_14 euxassay_008201_15
EMAGE:30818 EMAGE:30818 EMAGE:30818 EMAGE:30818 EMAGE:30818
euxassay_008201_16 euxassay_008201_17 euxassay_008201_18 euxassay_008201_19 euxassay_008201_20
EMAGE:30818 EMAGE:30818 EMAGE:30818 EMAGE:30818
euxassay_008201_21 euxassay_008201_22 euxassay_008201_23 euxassay_008201_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
forelimb digit 2 metacarpal
strong strong
regionalstrong expression: see section 03
heart ventricle
moderate moderate
spottedmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
sternum
strong strong
regionalstrong expression: see section 14 15 16 17 18
forelimb digit 2 phalanx
strong strong
regionalstrong expression: see section 03 04 05 06 07 22 23 24
forelimb digit 3 metacarpal
strong strong
regionalstrong expression: see section 24
humerus
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 23 24
forelimb digit 3 phalanx
strong strong
regionalstrong expression: see section 04 05
pelvic girdle skeleton
strong strong
regionalstrong expression: see section 08 09 10 11 19 20
axial skeleton
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17 18 19 20 21 22
left lung
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13
forelimb digit 1 metacarpal
strong strong
regionalstrong expression: see section 02 03
forelimb digit 1 phalanx
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 22 23 24
eye skeletal muscle
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 22 23 24
leg muscle
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 21 22 23 24
arm muscle
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 23 24
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
naris
strong strong
regionalstrong expression: see section 13 14 15 16
nasal septum
strong strong
regionalstrong expression: see section 14
cricoid cartilage
strong strong
regionalstrong expression: see section 13 14 15 16 17 18
temporal bone petrous part
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 22 23 24
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 14 15 16 moderate expression: see section 17
thyroid cartilage
strong strong
regionalstrong expression: see section 13 14 15 16 17 18
trachea cartilaginous ring
strong strong
regionalstrong expression: see section 15 16
rib
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 17 18 19 20 21 22 23 24
pons ventricular layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 moderate expression: see section 17 18 19 20
foot mesenchyme
strong strong
regionalstrong expression: see section 03
tail paraxial mesenchyme
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17 18 19
pons mantle layer
moderate moderate
regionalmoderate expression: see section 18 19 20
tongue muscle
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17 18
arytenoid cartilage
strong strong
regionalstrong expression: see section 13 14 15 16 17 18
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 19 20 21 22
medulla oblongata alar plate ventricular layer
strong strong
regionalstrong expression: see section 12 13 14 15 16 moderate expression: see section 17
renal cortex
strong strong
regionalstrong expression: see section 08 09 10 11 19 20 21 22 23
lens
strong strong
regionalstrong expression: see section 01
scapula
strong strong
regionalstrong expression: see section 06 07 24
lower jaw incisor
strong strong
regionalstrong expression: see section 14 15 moderate expression: see section 12 16 17 18
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 12 13 14 15
hindlimb digit 5 mesenchyme
strong strong
regionalstrong expression: see section 06 07 23 24
hindlimb digit 4 mesenchyme
strong strong
regionalstrong expression: see section 04 05 06 07 23 24
clavicle
strong strong
regionalstrong expression: see section 12 19
tarsus
strong strong
regionalstrong expression: see section 04 05 06 24
nose
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 15 16 17 18 19 20 21
otic capsule
strong strong
regionalstrong expression: see section 10 11 12 18 19 20 21
diaphragm
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
pancreas
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 18 19
hindlimb digit 3 mesenchyme
strong strong
regionalstrong expression: see section 04 05 06 07 23 24
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
tibia
strong strong
regionalstrong expression: see section 01 02 03
lower leg rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 03 04
femur
strong strong
regionalstrong expression: see section 01 02 03 20 21 22 24
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18 19 20
heart valve
strong strong
regionalstrong expression: see section 13 14 15 16 17 18
orbito-sphenoid
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 20 21 22 23 24
right lung
strong strong
regionalstrong expression: see section 13 14 15 16 17 18 19 20 21 22 23 24
hindlimb digit 1 mesenchyme
strong strong
regionalstrong expression: see section 04 05 24
stomach
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11
fibula
strong strong
regionalstrong expression: see section 01 02 03
hindlimb digit 2 mesenchyme
strong strong
regionalstrong expression: see section 04 05 06 24
midgut
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17 18 19 20
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 15 16
basioccipital bone
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
basisphenoid bone
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 18 19 20 21 22
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 12 16 17
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T338
Entity Detected:Fgfrl1, ( MGI:2150920)
Sequence:sense strand is shown

>T338
CTGGCTTTGCCAGACCAAGAAGAAGCCATGTGCCCCAGCATCTACACTTCCTGTGCCTGGGCATCGTCCC
CCAGGGACATCCCGAGAACGCAGTGGTGACAAGGACCTGCCCTCATTGGCTGTGGGCATATGTGAGGAGC
ATGGATCCGCCATGGCCCCCCAGCACATCCTGGCCTCTGGCTCAACTGCTGGCCCCAAGCTGTACCCCAA
GCTATACACAGATGTGCACACACACACACATACACACACCTGCACTCACACGCTCTCATGTGGAGGGCAA
GGTTCATCAACACCAGCATGTCCACTATCAGTGCTAAATACAGCAAATCTCCAAGCACTGTGTCCTGAGG
TAGGCATATGGGGGCCAAGGCAACAGGTTGGGAGAATTGAGAACAATGGAGGAAGAGTATCTTAGGGTGC
CTTATGGTGGACACTCACAAACTTGGCCATATAGATGTATGTACTACCAGATGAACAGCCAGCCAGATTC
ACAC
Notes:The probe template was PCR amplified from IMAGE:3154662 using vector specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3154662 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_008201 same experiment
 EMAGE:29192 same embryo
 EMAGE:29463 same embryo
 EMAGE:29177 same embryo
 EMAGE:29176 same embryo
 EMAGE:29465 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS