Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30867

9330159F19Rik ( MGI:3036239)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30867 EMAGE:30867 EMAGE:30867 EMAGE:30867 EMAGE:30867
euxassay_006467_01 euxassay_006467_02 euxassay_006467_03 euxassay_006467_04 euxassay_006467_05
EMAGE:30867 EMAGE:30867 EMAGE:30867 EMAGE:30867 EMAGE:30867
euxassay_006467_06 euxassay_006467_07 euxassay_006467_08 euxassay_006467_09 euxassay_006467_10
EMAGE:30867 EMAGE:30867 EMAGE:30867 EMAGE:30867 EMAGE:30867
euxassay_006467_11 euxassay_006467_12 euxassay_006467_13 euxassay_006467_14 euxassay_006467_15
EMAGE:30867 EMAGE:30867 EMAGE:30867 EMAGE:30867 EMAGE:30867
euxassay_006467_16 euxassay_006467_17 euxassay_006467_18 euxassay_006467_19 euxassay_006467_20
EMAGE:30867 EMAGE:30867 EMAGE:30867 EMAGE:30867
euxassay_006467_21 euxassay_006467_22 euxassay_006467_23 euxassay_006467_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 11 12 13 weak expression: see section 14
facial vii ganglion
strong strong
regionalstrong expression: see section 04 20
not examined not examined
regionalnot examined expression: see section 02 03 04 23 24
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 04 23 24
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 06 07 15
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 17 18 19 20 21 moderate expression: see section 06 07 08 16
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 10 11 12 13 15 16 17 18 19
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 05 moderate expression: see section 06 16 17
spinal cord
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12
brain
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 05 moderate expression: see section 16
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35777
Entity Detected:9330159F19Rik, ( MGI:3036239)
Sequence:sense strand is shown

>T35777
ACACAGAGGGACCCAGTTAGAATTTACGACTGCAATTGTGAACCAACTCCAAGGAATGAAAAGCTGGCTG
CAAAGATTGACGAGTTTAACAGAACTGTTTTTAGAACAGACAGAAGTTGTCAAGCAATACAGCAAAGTGA
CATCTATACAAAATCGCCTGACAATCTCAATTCCTGTGATATCTCCACTGCTCAGAAAGCTTACCTATCA
GAAGTTGACAGTGGGACCAGTGTTCTGAAAGCTAGTGACAATGTGTCTGTGCCCATGGAAAATGTGTTCA
GTGATCCCGAAAAAATATACTCGGCAGACCTGGTCAATCAAACGCAGACACGTGAGAGCCCCAGCAGCTA
TCAGCTTATGCTCCATGAGCATGATTGGAGATCAAGCAATTTTTCTAGCCGGCCAAGATCAGCGGATCCC
AGATCAAATTACGGTGTTGTGGAAAAGCTGCTGAAAACCTATGAGACAGAGACAAGGTCTGCACTGCAAA
ACTCAAAAGGCTACAGGAATAACTGGACCAAATGCGGTTCTGATGAGTCCATAGCAGTGAAAGCCTCCAA
TGGAAAAGGATTTTCCCGACCTGCTAGACCAGCAAATCGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 82511. Forward Primer - name:082511_F_cDNA_9330159F19Rik, sequence:ACACAGAGGGACCCAGTTAGAA; Reverse Primer - name:082511_N_SP6_cDNA_9330159F19Rik, sequence:ACGATTTGCTGGTCTAGCAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_006467 same experiment
 EMAGE:30470 same embryo
 EMAGE:29233 same embryo
 EMAGE:29211 same embryo
 EMAGE:29238 same embryo
 EMAGE:31577 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS