Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30871

Alox12e ( MGI:1274790)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30871 EMAGE:30871 EMAGE:30871 EMAGE:30871 EMAGE:30871
euxassay_008889_01 euxassay_008889_02 euxassay_008889_03 euxassay_008889_04 euxassay_008889_05
EMAGE:30871 EMAGE:30871 EMAGE:30871 EMAGE:30871 EMAGE:30871
euxassay_008889_06 euxassay_008889_07 euxassay_008889_08 euxassay_008889_09 euxassay_008889_10
EMAGE:30871 EMAGE:30871 EMAGE:30871 EMAGE:30871 EMAGE:30871
euxassay_008889_11 euxassay_008889_12 euxassay_008889_13 euxassay_008889_14 euxassay_008889_15
EMAGE:30871 EMAGE:30871 EMAGE:30871 EMAGE:30871
euxassay_008889_16 euxassay_008889_17 euxassay_008889_18 euxassay_008889_19

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
lower jaw molar
strong strong
regionalstrong expression: see section 06 07 16
upper jaw molar
strong strong
regionalstrong expression: see section 06 07 16 17
thymus primordium
strong strong
spottedstrong expression: see section 08 09 11 12
vibrissa
strong strong
regionalstrong expression: see section 07 08 18 19
lower jaw incisor
strong strong
regionalstrong expression: see section 10 11
upper jaw incisor
strong strong
regionalstrong expression: see section 11 12
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T284
Entity Detected:Alox12e, ( MGI:1274790)
Sequence:sense strand is shown

>T284
GTCAAGTACAAGATCCTCGTAGCCACTGGAGACTCGGTTTTTGCGGGCTCCGCCAACCTGGTGCATCTGT
GGCTGGTGGGCGAGCATGGAGAGGCGGACCTTGGGAAGCAGCTGCGGCCACTGCTGGGAAGGAAGACAGA
GCTGGAGGTCGACGTCCCCTTGCATCTAGGGCGCCTCCTGGCGGTGAAGCTGCGCAAACAGAAAGGCCTA
TTGGATTCTGACTGGTTCTGCAAGAGCATCACTGTGCAGGGCCCTGGGACCCAAGGAGAAGCCTTTTTCC
CCTGCTACAGTTGGGTGCAGGGCAAGGAGACTATCTGCCTAACCGAGGGCACTGCCCTGAAGGTAACTGA
TGACACTCAGAACCTGTTTAGGAAGTATCGAGAGCAGGAGCTGGAGAACAGAAGGAATGTGTATCGGTGG
GGCTCCTGGAAGGAGGGATTAATCCTGCCTATAGCAGGGAGTACTGAACGGGACCTCCCCCGGAACCAGA
GATTCATGAAGGAT
Notes:The probe template was PCR amplified from IMAGE:2655887 using vector specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2655887 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_008889 same experiment
 EMAGE:30008 same embryo
 EMAGE:30021 same embryo
 EMAGE:30781 same embryo
 EMAGE:30887 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS