Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30950

Echs1 enoyl Coenzyme A hydratase, short chain, 1, mitochondrial ( MGI:2136460)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30950 EMAGE:30950 EMAGE:30950 EMAGE:30950 EMAGE:30950
euxassay_001897_01 euxassay_001897_02 euxassay_001897_03 euxassay_001897_04 euxassay_001897_05
EMAGE:30950 EMAGE:30950 EMAGE:30950 EMAGE:30950 EMAGE:30950
euxassay_001897_06 euxassay_001897_07 euxassay_001897_08 euxassay_001897_09 euxassay_001897_10
EMAGE:30950 EMAGE:30950 EMAGE:30950 EMAGE:30950 EMAGE:30950
euxassay_001897_11 euxassay_001897_12 euxassay_001897_13 euxassay_001897_14 euxassay_001897_15
EMAGE:30950 EMAGE:30950 EMAGE:30950 EMAGE:30950 EMAGE:30950
euxassay_001897_16 euxassay_001897_17 euxassay_001897_18 euxassay_001897_19 euxassay_001897_20
EMAGE:30950 EMAGE:30950 EMAGE:30950
euxassay_001897_21 euxassay_001897_22 euxassay_001897_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
adrenal gland
moderate moderate
regionalmoderate expression: see section 03 04 05 10 11
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20
olfactory cortex ventricular layer
strong strong
homogeneousstrong expression: see section 10 11 15 16
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T658
Entity Detected:Echs1, enoyl Coenzyme A hydratase, short chain, 1, mitochondrial ( MGI:2136460)
Sequence:sense strand is shown

>T658
CTGGATGTGATATCATCTATGCTGGCGAGAAAGCCCAGTTCGGTGGCCAGAAATCCTCCTGGGGACCATC
CCAGGTGCTGGAGGCACTCAGAGACTCACCCGAGCAGTCGGCAAATCGCTAGCAATGGAGATGGTCCTCA
CTGGTGACCGCATCTCAGCTCAGGATGCAAAGCAGGCAGGTCTTGTAAGCAAGATTTTTCCTGTTGAAAA
ACTGGTTGAAGAAGCCATCCAATGTGCAGAAAAAATTGCCAGCAATTCTAAAATCGTAGTAGCCATGGCG
AAAGAATCTGTGAATGCAGCCTTTGAGATGACGTTAACAGAAGGAAATAAGCTGGAGAAGAGGCTTTTCT
ATTCCACCTTTGCCACCGATGACCGGAGAGGAGGGATGACTGCATTTGTAGAGAAAAGGAAGGCCAACTT
CAANGACCACTGAGAACTGGCAGCTATACCGTTTGCCACCCTGGAAAGCTCAGCCTGTCCTTTGAGAGGC
AAATAAATGATCCAAAAGGGTAGTAGTGTCGGCCACAGT
Notes:The probe template was PCR amplified from IMAGE:1887728 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1887728 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_001897 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS