Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30967

Rps6ka6 ribosomal protein S6 kinase polypeptide 6 ( MGI:1914321)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30967 EMAGE:30967 EMAGE:30967 EMAGE:30967 EMAGE:30967
euxassay_012310_01 euxassay_012310_02 euxassay_012310_03 euxassay_012310_04 euxassay_012310_05
EMAGE:30967 EMAGE:30967 EMAGE:30967 EMAGE:30967 EMAGE:30967
euxassay_012310_06 euxassay_012310_07 euxassay_012310_08 euxassay_012310_09 euxassay_012310_10
EMAGE:30967 EMAGE:30967 EMAGE:30967 EMAGE:30967 EMAGE:30967
euxassay_012310_11 euxassay_012310_12 euxassay_012310_13 euxassay_012310_14 euxassay_012310_15
EMAGE:30967 EMAGE:30967 EMAGE:30967 EMAGE:30967 EMAGE:30967
euxassay_012310_16 euxassay_012310_17 euxassay_012310_18 euxassay_012310_19 euxassay_012310_20
EMAGE:30967 EMAGE:30967
euxassay_012310_21 euxassay_012310_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
cricoid cartilage
moderate moderate
regionalmoderate expression: see section 10
right lung
weak weak
regionalweak expression: see section 10 13 14 15 16 17 18 19 20
metanephros
weak weak
regionalweak expression: see section 18
thyroid cartilage
moderate moderate
regionalmoderate expression: see section 10 11 12 13
spinal cord
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15
brain
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
left lung
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10
arytenoid cartilage
moderate moderate
regionalmoderate expression: see section 10 11
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 07 08 13 14 15 16
vomeronasal organ
weak weak
regionalweak expression: see section 10 13
thymus primordium
weak weak
regionalweak expression: see section 10 12 13
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 08 16 17 18 19 20
renal cortex
weak weak
regionalweak expression: see section 08 15 16 17
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 07 08 09 10 12 13 14 15 16
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30464
Entity Detected:Rps6ka6, ribosomal protein S6 kinase polypeptide 6 ( MGI:1914321)
Sequence:sense strand is shown

>T30464
GCCAGTGCAAACGCTCATCAACTCTTCAAAGGATTCAGTTTTGTTGCGACTTCTATTGCCGAAGAATATA
AAATCACTCCTGTTACAAGTTCAAATGTATTACCAATCGTTCAGATAAATGGAAATGCTGCTCAATTTAG
TGAAGCTTATGAATTGAAAGAGGATATTGGTATTGGTTCTTATTCTGTTTGCAAGCGATGCATACACTCA
GCTTCCAATGTGGAATTTGCAGTCAAGATCATTGATAAAAATAAGAGAGACCCCTCAGAAGAAATTGAAA
TTTTGATGCGCTATGGACAACATCCCAACATTATCTCTTTAAAGGAGGTCTTTGATGATGGGAAATATGT
TTACCTTGTTACGGACTTGATGAAAGGAGGAGAACTTCTGGATCGGATTCTCAAAAAGAAATGTTTCTCA
GAGCAGGAAGCTAGTAATGTGCTGTATGTAATAACCAAGACAGTTGAATGCCTTCATTCTCAAGGAGTCG
TTCATCGTGATCTTAAGCCCAGTAATATTTTATATATGGATGAGTCAGCCCATCCAGATTCAATCAAGAT
CTGTGATTTTGGGTTTGCAAAACAGCTTCGTGGAGAAAATGGACTTCTGTTAACTCCGTGCTACACCGCA
AACTTTGTAGCACCTGAGGTTCTCACTCAACAGGGATATGATGCTGCCTGTGATATTTGGAGCTTAGGAG
TCCTTTTGTACACAATGTTGGCCGGCTACACTCCATTTTCCAACGGCCCCAATGATACTCCTGAGGAAAT
ACTGCTGCGCATAGGCAACGGGAGGTTCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:30015425), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 58875. Forward Primer - name:058875_F_IRAV106_g10_Rps6ka6, sequence:GCCAGTGCAAACGCTCAT; Reverse Primer - name:058875_R_SP6_IRAV106_g10_Rps6ka6, sequence:GAGAACCTCCCGTTGCC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_012310 same experiment
 EMAGE:29847 same embryo
 EMAGE:29848 same embryo
 EMAGE:30993 same embryo
 EMAGE:29300 same embryo
 EMAGE:29855 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS