Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30990

Gdpd1 ( MGI:1913819)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30990 EMAGE:30990 EMAGE:30990 EMAGE:30990 EMAGE:30990
euxassay_009145_01 euxassay_009145_02 euxassay_009145_03 euxassay_009145_04 euxassay_009145_05
EMAGE:30990 EMAGE:30990 EMAGE:30990 EMAGE:30990 EMAGE:30990
euxassay_009145_06 euxassay_009145_07 euxassay_009145_08 euxassay_009145_09 euxassay_009145_10
EMAGE:30990 EMAGE:30990 EMAGE:30990 EMAGE:30990 EMAGE:30990
euxassay_009145_11 euxassay_009145_12 euxassay_009145_13 euxassay_009145_14 euxassay_009145_15
EMAGE:30990 EMAGE:30990 EMAGE:30990 EMAGE:30990 EMAGE:30990
euxassay_009145_16 euxassay_009145_17 euxassay_009145_18 euxassay_009145_19 euxassay_009145_20
EMAGE:30990 EMAGE:30990 EMAGE:30990 EMAGE:30990
euxassay_009145_21 euxassay_009145_22 euxassay_009145_23 euxassay_009145_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 05 06 16 17
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 07 13
spinal cord
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12
rectum
strong strong
regionalstrong expression: see section 12 13
trigeminal v nerve
strong strong
regionalstrong expression: see section 09 16
thoracic ganglion
strong strong
regionalstrong expression: see section 09 10 11 12
bladder
strong strong
regionalstrong expression: see section 12 13
facial vii ganglion
strong strong
regionalstrong expression: see section 03 04 05 17 18 19
lower jaw molar
strong strong
regionalstrong expression: see section 06 07 19
vagus x ganglion
strong strong
regionalstrong expression: see section 06 15
upper jaw molar
strong strong
regionalstrong expression: see section 06 07
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 15 16 17 18 19 20
vibrissa
strong strong
regionalstrong expression: see section 05 06 07 08 09 20 21 22 23 moderate expression: see section 24
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18
cervical ganglion
strong strong
regionalstrong expression: see section 07 15 moderate expression: see section 06
stomach
strong strong
spottedstrong expression: see section 07 08 09 10 moderate expression: see section 01 02 03 04 05 06
kidney calyx
moderate moderate
regionalmoderate expression: see section 05 06 07 08 13 14 15 16
urethra of male
strong strong
regionalstrong expression: see section 14
brain
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 05 15 16
retina
strong strong
regionalstrong expression: see section 01 02 03 04 21 22 23 24
midgut
strong strong
spottedstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
dorsal root ganglion
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14
submandibular gland primordium
strong strong
regionalstrong expression: see section 08 09 16
vomeronasal organ
strong strong
regionalstrong expression: see section 12 15
adrenal medulla
moderate moderate
regionalmoderate expression: see section 05 06 07 13 14
lower jaw incisor
strong strong
regionalstrong expression: see section 12 13
upper jaw incisor
strong strong
regionalstrong expression: see section 12 13
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2432
Entity Detected:Gdpd1, ( MGI:1913819)
Sequence:sense strand is shown

>T2432
TGGCCTCGAGCCAGANTTCGGCACGAGGCATTTTTTAAGTCTGTACGGGAATGTAGGAACGTCCCTGTCT
TGTGTATTTATTTTCACCAATATTTGCATATTTTACATTGGTAACTTGTTTGAAGGTAACTGGCAACTGA
AATGTAGATCATTGATCAAGATGTCTGCATATGATGCAGCTTTCTACTATTGTAAATCTGAAATCAAAGA
CTGGAGGCAAACTATGTGTTAGCCTTCACTGAGACAGGATCAACCATAGGAAAGAAGATTCCTGAGCCGG
GCATGGTGACATGAGCCTGCAGTGCCACCACACGGGGTGGGGAGCTAAGGCAAGAGGATCAGGGGGTTGA
GGCCAGCTTGGGCTACATAGTGAAAAACCCTGTCCTTAATTTTTTTTTATAAGAAAGCAGAAAATTATTG
AAGGCCATTACAGCCGTTCTGAATTATCTCGTATGTCTAGGTACGTCTTAGTTTAGGGGAAATTGAGGGG
NAAGAGGAAACCCGAAGGTGCAGCC
Notes:The probe template was PCR amplified from IMAGE:1244271 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1244271 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009145 same experiment
 EMAGE:32032 same embryo
 EMAGE:31439 same embryo
 EMAGE:32036 same embryo
 EMAGE:32038 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS