Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31008

Bphl ( MGI:1915271)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31008 EMAGE:31008 EMAGE:31008 EMAGE:31008 EMAGE:31008
euxassay_000541_01 euxassay_000541_02 euxassay_000541_03 euxassay_000541_04 euxassay_000541_05
EMAGE:31008 EMAGE:31008 EMAGE:31008 EMAGE:31008 EMAGE:31008
euxassay_000541_06 euxassay_000541_07 euxassay_000541_08 euxassay_000541_09 euxassay_000541_10
EMAGE:31008 EMAGE:31008 EMAGE:31008 EMAGE:31008 EMAGE:31008
euxassay_000541_11 euxassay_000541_12 euxassay_000541_13 euxassay_000541_14 euxassay_000541_15
EMAGE:31008 EMAGE:31008 EMAGE:31008 EMAGE:31008 EMAGE:31008
euxassay_000541_16 euxassay_000541_17 euxassay_000541_18 euxassay_000541_19 euxassay_000541_20
EMAGE:31008 EMAGE:31008 EMAGE:31008 EMAGE:31008
euxassay_000541_21 euxassay_000541_22 euxassay_000541_23 euxassay_000541_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
choroid invagination
strong strong
homogeneousstrong expression: see section 04 08 12
choroid fissure
strong strong
homogeneousstrong expression: see section 08 12 15 17
medulla oblongata part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 04 07 12 13 14 15 16 17 18 19 20
atrioventricular canal
weak weak
homogeneousweak expression: see section 03
metencephalon part of 4th ventricle choroid plexus
strong strong
homogeneousstrong expression: see section 04 08 09 10
trigeminal v ganglion
strong strong
homogeneousstrong expression: see section 11 moderate expression: see section 10
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 11 weak expression: see section 03 04 05 06 07 10
lateral ventricle choroid plexus
strong strong
regionalstrong expression: see section 04 08 09 10 11 15 16 17 18 19
3rd ventricle choroid plexus
strong strong
homogeneousstrong expression: see section 04 13
nasal septum
strong strong
gradedstrong expression: see section 11 weak expression: see section 10
nose
weak weak
gradedweak expression: see section 09 10
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T753
Entity Detected:Bphl, ( MGI:1915271)
Sequence:sense strand is shown

>T753
ATCTCGAGCCTGTTGGCCTACTGGATGCGCGTTCCTNAAAGCTTGTGCGACCTGGAGCTATGGCGACCGC
AACAGTTCGCCCGGCGGCCCAGCGGNTGCGGCTGCTCCTCTCGCCCCTGAAATCCCGGATCTGCGTACCC
CAGGCCGAACCCGTAGCCACCTTCGGCACTGCAGTAACTTCTGCCAAGGTGGCTGTGAATGGCGTTCACC
TGCATTACCAGCGCGTGGGAGAAGGGGAACATGCGATCCTCCTGCTTCCTGGGATGTTGGGTAGCGGAAA
GACCGATTTTGCACCTCAGCTTCAGAGCCTAAATAAGAAGCGCTTCACATTGGTGGCCTGGGACCCTCGA
GGATATGGATATTCCAGACCCCCAGATCGAGATTTTCCACGGGATTTTTTTGAAAGGGATGCAAAGGATG
CTGTTGACTTGATGAAGGCTCTACAGTTCAAGCAGGTCTCCCTCCTGGGCTGGAGTGATGGCGGCATAAC
TGCGCTCATCGCTGCTGCAAAGTACCCATCTTATATCCGCAAGATGGTGATCTGGGGAGCAAATGCCTAT
GTCAC
Notes:The probe template was PCR amplified from IMAGE:1891084 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1891084 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000541 same experiment
 EMAGE:30129 same embryo
 EMAGE:30580 same embryo
 EMAGE:29204 same embryo
 EMAGE:30126 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS