Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31034

Samd10 ( MGI:2443872)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31034 EMAGE:31034 EMAGE:31034 EMAGE:31034 EMAGE:31034
euxassay_009115_01 euxassay_009115_02 euxassay_009115_03 euxassay_009115_04 euxassay_009115_05
EMAGE:31034 EMAGE:31034 EMAGE:31034 EMAGE:31034 EMAGE:31034
euxassay_009115_06 euxassay_009115_07 euxassay_009115_08 euxassay_009115_09 euxassay_009115_10
EMAGE:31034 EMAGE:31034 EMAGE:31034 EMAGE:31034 EMAGE:31034
euxassay_009115_11 euxassay_009115_12 euxassay_009115_13 euxassay_009115_14 euxassay_009115_15
EMAGE:31034 EMAGE:31034 EMAGE:31034 EMAGE:31034 EMAGE:31034
euxassay_009115_16 euxassay_009115_17 euxassay_009115_18 euxassay_009115_19 euxassay_009115_20
EMAGE:31034 EMAGE:31034 EMAGE:31034 EMAGE:31034
euxassay_009115_21 euxassay_009115_22 euxassay_009115_23 euxassay_009115_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
neural retina
moderate moderate
regionalmoderate expression: see section 23 24 weak expression: see section 02 03
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 07 08 18
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 09 weak expression: see section 15
spinal cord
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16
brain
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 weak expression: see section 01 02 04 05
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 18 19
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 09 17
thoracic ganglion
weak weak
regionalweak expression: see section 12 13 14
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 16 17 18 weak expression: see section 15
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 19 20 21
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07 08 17 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 17 18 19 20 21 22
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 12 13 15 16 17 18 weak expression: see section 09 10 11 19
cervical ganglion
moderate moderate
regionalmoderate expression: see section 08 17
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2387
Entity Detected:Samd10, ( MGI:2443872)
Sequence:sense strand is shown

>T2387
TGGCCTCGAGCCAGATTCGGACGAGGGGGGGCTGTTGCTGCCAGGAAGGAGGACAAGGAGGATGACCCTG
GCAGCTCACTCTCACTCTGCTCTCTACCAACGTTCCCAGGGACTCCAAAATCTCAGGGACAGTTGAGGCT
CAGCCTCCAGTCCCCTCTGTGTGCCAAGAGCTGGCCTCGATTCAAGGTTGCTCATTACAGTTAATTTGGG
CCATTGGCCTGGCATCTTCCATCCTGTATGCCCTCCATCCATGGAAGGGGGCTCCCTTATTGTGTTTGCC
TGCCTCTAGAATCCCCCAGTCCTGGTGCCTGCAGCCAGAGGGCCCTCTCTGTCCCCCCTCTCTCTGTCTT
TTCTTCCCTATGCCCCTGTCCTTTCTTCCTTGGTTTTTGGTCACTTTTTATATATACTCTGACAAAAAAA
AAATCAGAAATAAATCTGGTTCTCNAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:1195260 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1195260 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009115 same experiment
 EMAGE:29562 same embryo
 EMAGE:30125 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS