Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31038

Slco3a1 ( MGI:1351867)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31038 EMAGE:31038 EMAGE:31038 EMAGE:31038 EMAGE:31038
euxassay_000780_01 euxassay_000780_02 euxassay_000780_03 euxassay_000780_04 euxassay_000780_05
EMAGE:31038 EMAGE:31038 EMAGE:31038 EMAGE:31038 EMAGE:31038
euxassay_000780_06 euxassay_000780_07 euxassay_000780_08 euxassay_000780_09 euxassay_000780_10
EMAGE:31038 EMAGE:31038 EMAGE:31038 EMAGE:31038 EMAGE:31038
euxassay_000780_11 euxassay_000780_12 euxassay_000780_13 euxassay_000780_14 euxassay_000780_15
EMAGE:31038 EMAGE:31038 EMAGE:31038 EMAGE:31038 EMAGE:31038
euxassay_000780_16 euxassay_000780_17 euxassay_000780_18 euxassay_000780_19 euxassay_000780_20
EMAGE:31038 EMAGE:31038
euxassay_000780_21 euxassay_000780_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 11 12 17 18 weak expression: see section 09 13 16
not examined not examined
regionalnot examined expression: see section 08 09 17 18
cervical ganglion
weak weak
regionalweak expression: see section 08 09 17
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 10 11 17
thoracic ganglion
weak weak
regionalweak expression: see section 12 13 14 15 16
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T131
Entity Detected:Slco3a1, ( MGI:1351867)
Sequence:sense strand is shown

>T131
GCGGCGGCGGCGGCGGGGGAAGGATGCAGGGAAAGAAGCCGGGCGGCTCGTCGGGCGGCGGCCGGAGCGG
CGAGCTGCAGGGGGACGAGGCGCAGAGGAACAAGAAGAAGAAAAAGAAGGTGTCCTGCTTCTCCAACATC
AAGATCTTCCTGGTGTCTGAGTGCGCCTTGATGCTGGCGCAGGGTACGGTGGGCGCCTACCTGGTGAGCG
TGTTGACCACCCTGGAACGCAGGTTCAACCTCCAGAGCGCCGATGTGGGTGTGATCGCCAGCAGCTTTGA
GATCGGCAACCTGGCGCTGATTCTCTTCGTAAGTTACTTTGGAGCACGTGGGCACCGACCGCGCCTCATC
GGCTGTGGTGGAATCGTCATGGCACTGGGCGCCCTGCTTTCGGCACTGCCTGAGTTCCTCACCCACCAGT
ACAAGTACGAGGCTGGCGAGATCCGATGGGGAGCAGAAGGCCGCGATGTCTGTGCCACCAATGGGTCCAG
CAGTGATGAGGGGCCCGACCCGGACCTAAT
Notes:The probe template was PCR amplified from IMAGE:2598913 using vector specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2598913 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000780 same experiment
 EMAGE:30270 same embryo
 EMAGE:30263 same embryo
 EMAGE:29333 same embryo
 EMAGE:31090 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS