Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31073

Mdk ( MGI:96949)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31073 EMAGE:31073 EMAGE:31073 EMAGE:31073 EMAGE:31073
euxassay_000525_01 euxassay_000525_02 euxassay_000525_03 euxassay_000525_04 euxassay_000525_05
EMAGE:31073 EMAGE:31073 EMAGE:31073 EMAGE:31073 EMAGE:31073
euxassay_000525_06 euxassay_000525_07 euxassay_000525_08 euxassay_000525_09 euxassay_000525_10
EMAGE:31073 EMAGE:31073 EMAGE:31073 EMAGE:31073 EMAGE:31073
euxassay_000525_11 euxassay_000525_12 euxassay_000525_13 euxassay_000525_14 euxassay_000525_15
EMAGE:31073 EMAGE:31073 EMAGE:31073 EMAGE:31073 EMAGE:31073
euxassay_000525_16 euxassay_000525_17 euxassay_000525_18 euxassay_000525_19 euxassay_000525_20
EMAGE:31073 EMAGE:31073
euxassay_000525_21 euxassay_000525_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
anal region
strong strong
regionalstrong expression: see section 11
gut
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17
spleen primordium
moderate moderate
homogeneousmoderate expression: see section 20 21 22
physiological umbilical hernia
strong strong
regionalstrong expression: see section 13 14
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 02 03 04 05 06 07 08 09 10 13 14 15 16 17 18 19 20 21 moderate expression: see section 01 11
head mesenchyme
strong strong
regionalstrong expression: see section 02 04 05 06 07 08 09 10 12 13 14 15 16 17 18 20 21 22 moderate expression: see section 23
mesenchyme
strong strong
regionalstrong expression: see section 02 03 05 06 07 12 18
metanephros
strong strong
regionalstrong expression: see section 06 07 08 09 15 16 17 18 19
glans of male genital tubercle
strong strong
regionalstrong expression: see section 11 12 14
lung
strong strong
regionalstrong expression: see section 08 09 10 15 16 17 18 19 20 21 22
trunk mesenchyme
strong strong
regionalstrong expression: see section 02 04 05 06 07 08 09 10 12 13 14 15 16 17 18 20 21 22 moderate expression: see section 23
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3684
Entity Detected:Mdk, ( MGI:96949)
Sequence:sense strand is shown

>T3684
TGGCCTCGAGCCAGATTCGGATGAGGGCCCTGCACCTCCAAGACCAAGTCAAAGACCAAAGCCAAGAAAG
GAAAAGGAAAGGACTAAGTCAGGAGGCCAGAGAGCCTCCGGCCTCGCCTGGAGCCTGAACGGAGCCCTCC
TCTCCCACAGGCCCAAGATATAACCCACCAGTGCCTTTTGTCTTCCTGTCAGCTCTGTCAATCACGCCTG
TCCTCTCACGCCCACACCAAGTGCCCAAAGTGGGGAGGGACAAGAGATTCTGGAAAGTGAGCCTCCCCAT
ACCCTCTTTTGTTCTCCCCACCCTGATACTTGTTATTAAGAAATGAATAAAATAAACTCACTTTTTTCCA
ATAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:353429 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:353429 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000525 same experiment
 EMAGE:31076 same embryo
 EMAGE:31102 same embryo
 EMAGE:31101 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS