Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31076

Mcm3ap minichromosome maintenance deficient 3 (S. cerevisiae) associated protein ( MGI:1930089)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31076 EMAGE:31076 EMAGE:31076 EMAGE:31076 EMAGE:31076
euxassay_000524_01 euxassay_000524_02 euxassay_000524_03 euxassay_000524_04 euxassay_000524_05
EMAGE:31076 EMAGE:31076 EMAGE:31076 EMAGE:31076 EMAGE:31076
euxassay_000524_06 euxassay_000524_07 euxassay_000524_08 euxassay_000524_09 euxassay_000524_10
EMAGE:31076 EMAGE:31076 EMAGE:31076 EMAGE:31076 EMAGE:31076
euxassay_000524_11 euxassay_000524_12 euxassay_000524_13 euxassay_000524_14 euxassay_000524_15
EMAGE:31076 EMAGE:31076 EMAGE:31076 EMAGE:31076 EMAGE:31076
euxassay_000524_16 euxassay_000524_17 euxassay_000524_18 euxassay_000524_20 euxassay_000524_21
EMAGE:31076 EMAGE:31076 EMAGE:31076
euxassay_000524_22 euxassay_000524_23 euxassay_000524_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
midbrain
strong strong
regionalstrong expression: see section 14 moderate expression: see section 13
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 09 10 moderate expression: see section 11 15 17 21 weak expression: see section 16 18 20 22
head mesenchyme
moderate moderate
homogeneousmoderate expression: see section 17 weak expression: see section 10 11 12 13 15 16 18 21 22
metanephros
strong strong
regionalstrong expression: see section 09 moderate expression: see section 10 17 weak expression: see section 18
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3729
Entity Detected:Mcm3ap, minichromosome maintenance deficient 3 (S. cerevisiae) associated protein ( MGI:1930089)
Sequence:sense strand is shown

>T3729
TGGCCTCGAGCCAGAATTCGGCACGAGGCACAGGCATTCACAGAGTCAACTCGGCTTCCTCTCTACCTCC
CTCAGACGCTAGTGTCCTTTCCTGATTCTATCAAAACTCAGACCATGGTGAAAACATCTACAAGTCCTCA
GAATTCAGGAACAGGAAAGCAGTTGAGGTTCTCAGAGGCATCCGGTTCATCCCTGACGGAAAAGCTGAAG
CTCCTGGAAAGGCTGATCCAGAGCTCAAGGGCGGAAGAAGCAGCCTCCGAGCTGCACCTCTCTGCACTGC
TGGAGATGGTGGACATGTAGCTGTCTGACGGGAGACGGATCTCTAATTCATAATGCTTTGTCTGTATTCA
ATTGTGTTATAGATGCTGTTGGAAATGTGACTATTAATTATGCAAATAAACTTTTTGAATCATTCCAAAA
AAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:367240 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:367240 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000524 same experiment
 EMAGE:31073 same embryo
 EMAGE:31102 same embryo
 EMAGE:31101 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS