Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31090

Sestd1 ( MGI:1916262)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31090 EMAGE:31090 EMAGE:31090 EMAGE:31090 EMAGE:31090
euxassay_000779_01 euxassay_000779_02 euxassay_000779_03 euxassay_000779_04 euxassay_000779_05
EMAGE:31090 EMAGE:31090 EMAGE:31090 EMAGE:31090 EMAGE:31090
euxassay_000779_06 euxassay_000779_07 euxassay_000779_08 euxassay_000779_09 euxassay_000779_10
EMAGE:31090 EMAGE:31090 EMAGE:31090 EMAGE:31090 EMAGE:31090
euxassay_000779_11 euxassay_000779_12 euxassay_000779_13 euxassay_000779_14 euxassay_000779_15
EMAGE:31090 EMAGE:31090 EMAGE:31090 EMAGE:31090 EMAGE:31090
euxassay_000779_16 euxassay_000779_17 euxassay_000779_18 euxassay_000779_19 euxassay_000779_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 15 16 weak expression: see section 17
facial vii ganglion
moderate moderate
homogeneousmoderate expression: see section 03 04 18 19 weak expression: see section 17
vagus x ganglion
weak weak
homogeneousweak expression: see section 07
trigeminal v ganglion
moderate moderate
homogeneousmoderate expression: see section 02 03 04 05 06 07 15 16 17 18 19 weak expression: see section 08 20
vestibulocochlear viii ganglion vestibular component
moderate moderate
homogeneousmoderate expression: see section 04 18
superior glossopharyngeal ix ganglion
weak weak
homogeneousweak expression: see section 05 06 17
inferior glossopharyngeal ix ganglion
weak weak
homogeneousweak expression: see section 05 06 17
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T129
Entity Detected:Sestd1, ( MGI:1916262)
Sequence:sense strand is shown

>T129
AGGACATGGTAGATGTGCGGAGGCTGAAGATGCTTCAGATGGTGCAGTTGTTTAAGTGTGAAGAGGATGC
TTCACAGGCAGTAGAATGGCTGAGTGAACTTCTGGATGCCCTGCTGAAGACCCATATCAGGCTGGGTGAC
GATGCTCAGGAAACAAAGGTTTTACTGGAAAAACACAGAAAATTTGTCGATGTTGCCCAGAGTACTTACG
ACTATGGCAGACAGCTGCTGCAGGCCACAGTTGTACTGTGCCAGTCTCTGCGCTGCACTTCCCGGTCCTC
AGGGGACACACTTCCTCGACTGAACAGAGTGTGGAAGCAGTTTACAGTCGCATCTGAAGAGAGAGTGCAC
AGGTTGGAGATGGCTATTGCCTTTCACTCCAATGCCGAAAAGATTTTGCAAGACTGCCCAGAAGAGCCTG
AAGCAATGAATGATGAGGAACAGTTTGAGGAAATTGAAGCAATTGGAAAATCACT
Notes:The probe template was PCR amplified from IMAGE:2581948 using vector specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2581948 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000779 same experiment
 EMAGE:30270 same embryo
 EMAGE:30263 same embryo
 EMAGE:29333 same embryo
 EMAGE:31038 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS