Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31221

Pnliprp1 ( MGI:97723)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31221 EMAGE:31221 EMAGE:31221 EMAGE:31221 EMAGE:31221
euxassay_000489_01 euxassay_000489_02 euxassay_000489_03 euxassay_000489_04 euxassay_000489_05
EMAGE:31221 EMAGE:31221 EMAGE:31221 EMAGE:31221 EMAGE:31221
euxassay_000489_06 euxassay_000489_07 euxassay_000489_08 euxassay_000489_09 euxassay_000489_10
EMAGE:31221 EMAGE:31221 EMAGE:31221 EMAGE:31221 EMAGE:31221
euxassay_000489_11 euxassay_000489_12 euxassay_000489_13 euxassay_000489_14 euxassay_000489_15
EMAGE:31221 EMAGE:31221 EMAGE:31221 EMAGE:31221 EMAGE:31221
euxassay_000489_16 euxassay_000489_17 euxassay_000489_18 euxassay_000489_19 euxassay_000489_20
EMAGE:31221 EMAGE:31221 EMAGE:31221 EMAGE:31221
euxassay_000489_21 euxassay_000489_22 euxassay_000489_23 euxassay_000489_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
pancreas
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2201
Entity Detected:Pnliprp1, ( MGI:97723)
Sequence:sense strand is shown

>T2201
TGGCCTCGAGCCAGATTCGTCGACTAGCCAAGCTTGATGTGGGAACAATTGAGAAAGTCAAGTTTCTTTG
GAATAACCACGTGGTAAACCCAAGTTTCCCCAAAGTGGGCGCAGCCAAGATCACTGTGCAAAAGGGGGAG
GAGCGGACAGAGCACAACTTCTGTAGTGAAGAGACCGTGAGAGAAGACATCCTGCTCACTCTCTTGCCTT
GTAAAACCTCAGACACAATGTGACCTCTTGGTAACACCAATAAAATCATCAGCTGCACCTACCCAAAAAA
AAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:905599 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:905599 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000489 same experiment
 EMAGE:31309 same embryo
 EMAGE:30296 same embryo
 EMAGE:30278 same embryo
 EMAGE:31236 same embryo
 EMAGE:30279 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS