Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31236

Leng9 ( MGI:2444509)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31236 EMAGE:31236 EMAGE:31236 EMAGE:31236 EMAGE:31236
euxassay_000482_11 euxassay_000482_01 euxassay_000482_02 euxassay_000482_03 euxassay_000482_04
EMAGE:31236 EMAGE:31236 EMAGE:31236 EMAGE:31236 EMAGE:31236
euxassay_000482_05 euxassay_000482_06 euxassay_000482_07 euxassay_000482_08 euxassay_000482_09
EMAGE:31236 EMAGE:31236 EMAGE:31236 EMAGE:31236 EMAGE:31236
euxassay_000482_10 euxassay_000482_12 euxassay_000482_13 euxassay_000482_14 euxassay_000482_15
EMAGE:31236 EMAGE:31236 EMAGE:31236 EMAGE:31236 EMAGE:31236
euxassay_000482_16 euxassay_000482_17 euxassay_000482_18 euxassay_000482_19 euxassay_000482_20
EMAGE:31236 EMAGE:31236 EMAGE:31236 EMAGE:31236
euxassay_000482_21 euxassay_000482_22 euxassay_000482_23 euxassay_000482_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
vestibulocochlear viii ganglion
strong strong
homogeneousstrong expression: see section 18
metanephros
moderate moderate
regionalmoderate expression: see section 10 weak expression: see section 21
not examined not examined
othernot examined expression: see section 02
spinal cord
moderate moderate
homogeneousmoderate expression: see section 10 weak expression: see section 02
glossopharyngeal ix ganglion
strong strong
homogeneousstrong expression: see section 05 21
dorsal root ganglion
strong strong
homogeneousstrong expression: see section 04 05 10 moderate expression: see section 23 weak expression: see section 22
not examined not examined
othernot examined expression: see section 02
cerebral cortex ventricular layer
strong strong
homogeneousstrong expression: see section 10 15 16 18 19 21 moderate expression: see section 04 06 12 13 14 20 22 weak expression: see section 02 05
cerebral cortex marginal layer
strong strong
homogeneousstrong expression: see section 15 16 17 21 moderate expression: see section 12 13 14 22
vagus x ganglion
strong strong
homogeneousstrong expression: see section 05 21 weak expression: see section 20
heart
strong strong
single cellstrong expression: see section 01
trigeminal v ganglion
strong strong
homogeneousstrong expression: see section 04 05 06 07 12 15 16 17 18 19 21 weak expression: see section 20
vibrissa
moderate moderate
regionalmoderate expression: see section 18
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 17
cranial ganglion
strong strong
homogeneousstrong expression: see section 04
lung
strong strong
single cellstrong expression: see section 03 moderate expression: see section 05
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2207
Entity Detected:Leng9, ( MGI:2444509)
Sequence:sense strand is shown

>T2207
TGGCCTCGAGCCAGATTCGGACGAGGGGACTTGGTTCTTCTGGGCCATCATGTGCTCTGTGCCACACCCT
CCCCCACACTGACAGGTATGGCCCAAACACTGAATCAGAGGCTAGAGGCCGAAGGGCTTAGAGTGGTGCT
GCTGCCAGAACTACAACCGCACCTCACCCTGGCTAAGGTACCACATGGAACCCAGGTCTGCCTCCCTAAG
CCTGAGTACACCCTGAACCAGGAGCTAGGAAGGCAGCCCCTAAGTAAACTCTGGCTTTGCCGCATGGGTA
GAGCAGGGCATAGCTATCTTCCCTTGGTAGAAATTTCCCTGAAATGACCGAGGTTTCATATTTCGGATAA
AACAGGCCAAGCAGAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:922416 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:922416 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000482 same experiment
 EMAGE:31309 same embryo
 EMAGE:30296 same embryo
 EMAGE:30278 same embryo
 EMAGE:31221 same embryo
 EMAGE:30279 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS