Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31249

Lzts1 ( MGI:2684762)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31249 EMAGE:31249 EMAGE:31249 EMAGE:31249 EMAGE:31249
euxassay_011133_01 euxassay_011133_02 euxassay_011133_03 euxassay_011133_04 euxassay_011133_05
EMAGE:31249 EMAGE:31249 EMAGE:31249 EMAGE:31249 EMAGE:31249
euxassay_011133_06 euxassay_011133_07 euxassay_011133_08 euxassay_011133_09 euxassay_011133_10
EMAGE:31249 EMAGE:31249 EMAGE:31249 EMAGE:31249 EMAGE:31249
euxassay_011133_11 euxassay_011133_12 euxassay_011133_13 euxassay_011133_14 euxassay_011133_15
EMAGE:31249 EMAGE:31249 EMAGE:31249 EMAGE:31249 EMAGE:31249
euxassay_011133_16 euxassay_011133_17 euxassay_011133_18 euxassay_011133_19 euxassay_011133_20
EMAGE:31249 EMAGE:31249 EMAGE:31249
euxassay_011133_21 euxassay_011133_22 euxassay_011133_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate marginal layer
moderate moderate
regionalmoderate expression: see section 05
cerebral cortex mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 moderate expression: see section 01 02 03 04 12 21 22
telencephalon mantle layer
weak weak
regionalweak expression: see section 23
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16
medulla oblongata alar plate marginal layer
moderate moderate
regionalmoderate expression: see section 05 06 07 17 18
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 12 13 14 15 17 18 19 20
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 11 13
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36608
Entity Detected:Lzts1, ( MGI:2684762)
Sequence:sense strand is shown

>T36608
GGTCAGACCGGAGTAGATTTTGATCCAGCCACCCCACCAAAGCTCATGCCCTTCTCCAATCAACTGGAAA
TGAGTTCAGACAAGGGGGCAGTAAGGCCCACTGCCTTCAAGCCTGTGCTGCCACGGTCAGGAGCCATCCT
CCACTCTTCACCTGAGAGTACCAGCCACCAACTTCATCCCATGCCTCCAGATAAGCCCAAGGAGCAGGAG
CTGAAGCCAGGCCTGTGCTCCGGGGCACTGTCTGACTCAGGCCGGAACTCCATGTCTAGCCTGCCCACGC
ATAGCACCACCAGCAGCTACCAGCTGGATCCTCTGGTCACCCCCGTGGGGCCTACCAGCCGTTTTGGGGG
TTCAGCTCACAACATCACACAAGGCATCATCCTTCAGGACAGTAATATGATGAGCCTGAAGGCTCTGTCG
TTCTCTGATGGCGGCAGCAAGCTGGCTCACCCAGGCAAGGCAGATAAGGGCGCCTCCTGTGTGCGTTCCC
CACTCTCCACGGATGAGTGCACCATCCAGGAGCTGGAGCAGAAGCTGCTGCAGAGGGAGACTGCACTACA
GAAGCTACAGCGCAGTTTCGATGAGAAGGAGTTTGCCTCTGGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 96419. Forward Primer - name:096419_F_cDNA_Lzts1, sequence:GGTCAGACCGGAGTAGATTTTG; Reverse Primer - name:096419_N_SP6_cDNA_Lzts1, sequence:GCCAGAGGCAAACTCCTTCT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_011133 same experiment
 EMAGE:29939 same embryo
 EMAGE:31250 same embryo
 EMAGE:32227 same embryo
 EMAGE:32206 same embryo
 EMAGE:31276 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS