Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31250

Ltbp3 latent transforming growth factor beta binding protein 3 ( MGI:1101355)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31250 EMAGE:31250 EMAGE:31250 EMAGE:31250 EMAGE:31250
euxassay_011132_01 euxassay_011132_02 euxassay_011132_03 euxassay_011132_04 euxassay_011132_05
EMAGE:31250 EMAGE:31250 EMAGE:31250 EMAGE:31250 EMAGE:31250
euxassay_011132_06 euxassay_011132_07 euxassay_011132_08 euxassay_011132_09 euxassay_011132_10
EMAGE:31250 EMAGE:31250 EMAGE:31250 EMAGE:31250 EMAGE:31250
euxassay_011132_11 euxassay_011132_12 euxassay_011132_13 euxassay_011132_14 euxassay_011132_15
EMAGE:31250 EMAGE:31250 EMAGE:31250 EMAGE:31250 EMAGE:31250
euxassay_011132_16 euxassay_011132_17 euxassay_011132_18 euxassay_011132_19 euxassay_011132_20
EMAGE:31250 EMAGE:31250 EMAGE:31250
euxassay_011132_21 euxassay_011132_22 euxassay_011132_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
sternum
strong strong
regionalstrong expression: see section 13 14 15 16
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 12
axial skeleton
strong strong
regionalstrong expression: see section 13 14 15 16 17 18 19 20
left lung
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14
lower leg mesenchyme
strong strong
regionalstrong expression: see section 02 03 04 05 06
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 13 14 moderate expression: see section 05 06 07 08 09 10 11 12 15 16 17 18 19 20 21
otic capsule
strong strong
regionalstrong expression: see section 07 08 17 18 19 20
diaphragm
strong strong
regionalstrong expression: see section 09 10 11 13 14 15 16 17 18 19 moderate expression: see section 12
upper arm mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 20 21 22 23
cerebral cortex ventricular layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 15 16 17 18 19 20 21 22
upper leg mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 07 08 10 11 20 21 22
midbrain ventricular layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 moderate expression: see section 17
heart valve
strong strong
regionalstrong expression: see section 12 13 14 15 16
hand
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 22 23
right lung
strong strong
regionalstrong expression: see section 15 16 17 18 19 20 21 22
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 13 14 moderate expression: see section 11 12 15 16
trachea cartilaginous ring
strong strong
regionalstrong expression: see section 14 15 16
rib
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 16 17 18 19 20 21 22 23 moderate expression: see section 03 04
pons ventricular layer
strong strong
regionalstrong expression: see section 13 14 moderate expression: see section 05 06 07 08 09 10 11 12 15 16 17 18 19 20 21
not examined not examined
regionalnot examined expression: see section 06 07
respiratory system cartilage
strong strong
regionalstrong expression: see section 13 14 15 16 17
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 14 15 moderate expression: see section 16
foot
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 20 21 22 23
basioccipital bone
strong strong
regionalstrong expression: see section 11 12 13 14 15 16
basisphenoid bone
strong strong
regionalstrong expression: see section 11 12 13 14 15 16
medulla oblongata alar plate ventricular layer
strong strong
regionalstrong expression: see section 05 06 07 09 10 13 14 17 18 19 20 21 moderate expression: see section 08 11 12 15 16
aorta
strong strong
regionalstrong expression: see section 13 14 15 16
forearm mesenchyme
strong strong
regionalstrong expression: see section 01 02
lung
strong strong
regionalstrong expression: see section 05
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 11 12 13
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36602
Entity Detected:Ltbp3, latent transforming growth factor beta binding protein 3 ( MGI:1101355)
Sequence:sense strand is shown

>T36602
CACAGTGTTCTGTGACAGCGTATTGGCTACCAATGTCACTCAGCAGGAATGCTGTTGCTCTCTGGGAGCT
GGCTGGGGAGACCACTGCGAAATCTATCCCTGTCCAGTCTACAGCTCAGCCGAATTTCACAGCCTGGTGC
CTGATGGGAAAAGGCTACACTCAGGACAACAACATTGTGAACTATGCATTCCTGCCCACCGTGACATCGA
CGAATGCATATTGTTTGGGGCAGAGATCTGCAAGGAGGGCAAGTGTGTGAACACGCAGCCCGGCTACGAG
TGCTACTGCAAGCAGGGCTTCTACTACGATGGCAACCTGCTGGAGTGCGTGGACGTGGATGAGTGCTTGG
ATGAGTCTAACTGCAGGAACGGAGTGTGTGAGAACACACGTGGCGGCTACCGCTGTGCCTGCACTCCGCC
GGCAGAGTACAGTCCCGCACAGGCCCAGTGTCTGATCCCGGAGAGATGGAGCACGCCCCAGAGAGACGTG
AAGTGTGCTGGGGCCAGCGAGGAGAGGACGGCATGTGTATGGGGCCCCTGGGCGGGACCTGCCCTCACTT
TTGATGACTGCTGCTGCCGCCAGCCGCGGCTGGGTACCCAGTGCAGACCGTGCCCGCCACGTGGCACCGG
GTCCCAGTGCCCGACTTCACAGAGTGAGAGCAATTCTTTCTGGGACACAAGCCCCCTGCTACTGGGGAAG
TCTCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 98064. Forward Primer - name:098064_F_cDNA_Ltbp3, sequence:CACAGTGTTCTGTGACAGCGTA; Reverse Primer - name:098064_N_SP6_cDNA_Ltbp3, sequence:GGAGACTTCCCCAGTAGCAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_011132 same experiment
 EMAGE:29939 same embryo
 EMAGE:32227 same embryo
 EMAGE:32206 same embryo
 EMAGE:31276 same embryo
 EMAGE:31249 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS