Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31262

Mrps23 mitochondrial ribosomal protein S23 ( MGI:1928138)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31262 EMAGE:31262 EMAGE:31262 EMAGE:31262 EMAGE:31262
euxassay_000251_09 euxassay_000251_01 euxassay_000251_02 euxassay_000251_03 euxassay_000251_04
EMAGE:31262 EMAGE:31262 EMAGE:31262 EMAGE:31262 EMAGE:31262
euxassay_000251_05 euxassay_000251_06 euxassay_000251_07 euxassay_000251_08 euxassay_000251_10
EMAGE:31262 EMAGE:31262 EMAGE:31262 EMAGE:31262 EMAGE:31262
euxassay_000251_11 euxassay_000251_12 euxassay_000251_13 euxassay_000251_14 euxassay_000251_15
EMAGE:31262 EMAGE:31262 EMAGE:31262 EMAGE:31262 EMAGE:31262
euxassay_000251_16 euxassay_000251_17 euxassay_000251_18 euxassay_000251_19 euxassay_000251_20
EMAGE:31262 EMAGE:31262 EMAGE:31262 EMAGE:31262
euxassay_000251_21 euxassay_000251_22 euxassay_000251_23 euxassay_000251_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
tail dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 15 16 17 18
metencephalon basal plate
weak weak
regionalweak expression: see section 07 17
ventral grey horn
weak weak
regionalweak expression: see section 10 11 12 13
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 07 18 19
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 18 19
medulla oblongata alar plate
weak weak
regionalweak expression: see section 11 13
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 20 21
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 16 17 18 19 20
medulla oblongata basal plate
weak weak
regionalweak expression: see section 08 09 15 16
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 08 18
thymus primordium
weak weak
homogeneousweak expression: see section 11 12 13 14 15
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 17 18 19 20 21 22
vibrissa
weak weak
regionalweak expression: see section 04 05 06 07 21 22
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1419
Entity Detected:Mrps23, mitochondrial ribosomal protein S23 ( MGI:1928138)
Sequence:sense strand is shown

>T1419
CTGATTTCTAGCCCAAGTGGCCATGGCGGGGAGCCGGCTGGAGACGGTGGGGAGCGTGTTCTCCCGGACG
AGGGATCTGATGCGGGCCGGGGTGTTGAAAGAGAAGCCACTGTGGTATGACATATACAAGGCCTTTCCAC
CCCTGAGAGAGCCTGTCTTCCGAAGGCCCCGCTTGCGATACGGCAAAGCCAAAGCTGACATCCAGGACAT
CTTTTACCAGGAGGATCAGATTCGAGCGAAATTCTTTGCAACCTATGGATCTGGTCAGAAAGCTTTTGAT
CTCTTCAACCCAAACTTCAAGTCTACCTGTCAGCGGTTTGTGGAGAAGTTCACAGAGCTTCAGAATCTTG
GAGAAACAGATGAAGAGAAGTTATTTGTAGAAACGGGGAAGGCTCTGTTGGCAGAAGGCATCATTTTAAG
AAGAGTTCGAGAAGCAAGGACTGTCAGCGTGAGACTCCAAGCTTCATCAGAAGGACATGAGCCTCAGGAA
GACGATGACCTGGCGCAGCGGGGGCAG
Notes:The probe template was PCR amplified from IMAGE:2394901 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2394901 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000251 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS