Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31264

Senp5 SUMO/sentrin specific peptidase 5 ( MGI:2443596)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31264 EMAGE:31264 EMAGE:31264 EMAGE:31264 EMAGE:31264
euxassay_002886_01 euxassay_002886_02 euxassay_002886_03 euxassay_002886_04 euxassay_002886_05
EMAGE:31264 EMAGE:31264 EMAGE:31264 EMAGE:31264 EMAGE:31264
euxassay_002886_06 euxassay_002886_07 euxassay_002886_08 euxassay_002886_09 euxassay_002886_10
EMAGE:31264 EMAGE:31264 EMAGE:31264 EMAGE:31264 EMAGE:31264
euxassay_002886_11 euxassay_002886_12 euxassay_002886_13 euxassay_002886_14 euxassay_002886_15
EMAGE:31264 EMAGE:31264 EMAGE:31264 EMAGE:31264 EMAGE:31264
euxassay_002886_16 euxassay_002886_17 euxassay_002886_18 euxassay_002886_19 euxassay_002886_20
EMAGE:31264 EMAGE:31264 EMAGE:31264 EMAGE:31264
euxassay_002886_21 euxassay_002886_22 euxassay_002886_23 euxassay_002886_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 09 10 11 16 17 18 19
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 17 18 19 20 21 22
cervical ganglion
weak weak
regionalweak expression: see section 09 17
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 11 17
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 08 18 19
thoracic ganglion
weak weak
regionalweak expression: see section 14
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T185
Entity Detected:Senp5, SUMO/sentrin specific peptidase 5 ( MGI:2443596)
Sequence:sense strand is shown

>T185
CCACAAGCTTCAGACTTTCCCATGAAGTTCAGTGGGGAGAGCCAAAGTCCAGGTGACAGTGGCAAGACTG
TGGTCTTGAACAAACATAGAAAGCGAGTTTGTCATGGCTGCTACCAAGGGCTAGAGCACCACAGGAACAG
GAGACCCCTGATTCCAAAGCAGTTCCAGCTTAACCAACACCGAAGAGTCAGAGCGTCTCTGATGATGTAT
GAGAAACTATCCATGATTAGATTTCGGTATAGGATTTTCAGATCCCAGCACTTCAGAACGAAAAGCAGAG
TTTGCAAGCTAAGAAAGGCCCAGCGAAGTTGGGTACAGAAGGTCACTGGGGACCATCAAGAGAACCTTAG
GGATAATAACACTGAGGGTGACAATTGCAATCCAGTCCCTTCCCTAGAACCTAAAGATCCTTGTCGGTGT
CAGCCATACTTTCCAGACATGGACAGCAGTGCTGTGGGGAAGGGAAAAAACTGTCACGTGCCTGATGGTC
ACACTA
Notes:The probe template was PCR amplified from IMAGE:2647150 using vector specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2647150 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002886 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS