Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31294

Flot1 ( MGI:1100500)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31294 EMAGE:31294 EMAGE:31294 EMAGE:31294 EMAGE:31294
euxassay_000221_01 euxassay_000221_02 euxassay_000221_03 euxassay_000221_04 euxassay_000221_05
EMAGE:31294 EMAGE:31294 EMAGE:31294 EMAGE:31294 EMAGE:31294
euxassay_000221_06 euxassay_000221_07 euxassay_000221_08 euxassay_000221_09 euxassay_000221_10
EMAGE:31294 EMAGE:31294 EMAGE:31294 EMAGE:31294 EMAGE:31294
euxassay_000221_11 euxassay_000221_12 euxassay_000221_13 euxassay_000221_14 euxassay_000221_15
EMAGE:31294 EMAGE:31294 EMAGE:31294 EMAGE:31294 EMAGE:31294
euxassay_000221_16 euxassay_000221_17 euxassay_000221_18 euxassay_000221_19 euxassay_000221_20
EMAGE:31294 EMAGE:31294 EMAGE:31294 EMAGE:31294
euxassay_000221_21 euxassay_000221_22 euxassay_000221_23 euxassay_000221_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
strong strong
homogeneousstrong expression: see section 07 08 09 10 13 14 15 19 20 21 22 24
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 08 09 10 19 20 21 23 24
facial vii ganglion
strong strong
homogeneousstrong expression: see section 03 04 05 06 16 17
vagus x ganglion
strong strong
homogeneousstrong expression: see section 05 06 07 08 14 15
trigeminal v ganglion
strong strong
homogeneousstrong expression: see section 03 04 05 06 07 08 09 13 14 15 16 17 18
nasal cavity respiratory epithelium
moderate moderate
single cellmoderate expression: see section 09
nasal cavity olfactory epithelium
moderate moderate
single cellmoderate expression: see section 10 13 19 20 23 24
midbrain mantle layer
strong strong
regionalstrong expression: see section 10
ventral grey horn
strong strong
homogeneousstrong expression: see section 10 13 19 20 22 23 24
vomeronasal organ epithelium
moderate moderate
homogeneousmoderate expression: see section 20 23
glossopharyngeal ix ganglion
strong strong
homogeneousstrong expression: see section 06 14 15 16
pons mantle layer
strong strong
single cellstrong expression: see section 06 07 10 13
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T423
Entity Detected:Flot1, ( MGI:1100500)
Sequence:sense strand is shown

>T423
GTCTGTTGCTGCAACAGGGTGCGGCCGGGTGGGGGGCGCAAGTGCAGCTTCCACTAAGCCGGGTGTCCGA
GCAGTCCCCACCCCGTTCTGGGGTTCTGCGGGCCTCCGCGCTTCTCAAGACCCCGGTGGGGTTGCTTACC
GGGACGTTCCGGAAGCTGCAGCTTCAACCATGTTTTTCACTTGTGGCCCAAATGAGGCCATGGTGGTCTC
CGGGTTCTGCAGGAGCCCCCCAGTCATGGTGGCCGGAGGCCGAGTGTTTGTCCTACCCTGCATTCAGCAA
ATCCAGAGGATCTCTCTCAACACACTGACCCTCAATGTCAAGAGTGAAAAGGTTTATACCCGCCACGGGG
TCCCCATCTCAGTCACGGGCATTGCCCAGGTGAAAATCCAGGGCCAGAACNAGGAGATGCTGGCAGCTGC
CTGCCAGATGTTCCTGGGGAAGACAGAGGCGGAGATTGCCCACATTGCCCTGGAGACACTGGAAGGCCA
Notes:The probe template was PCR amplified from IMAGE:3158071 using vector specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3158071 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000221 same experiment
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS