Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31299

Abhd11 abhydrolase domain containing 11 ( MGI:1916008)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31299 EMAGE:31299 EMAGE:31299 EMAGE:31299 EMAGE:31299
euxassay_000237_01 euxassay_000237_02 euxassay_000237_03 euxassay_000237_04 euxassay_000237_05
EMAGE:31299 EMAGE:31299 EMAGE:31299 EMAGE:31299 EMAGE:31299
euxassay_000237_06 euxassay_000237_07 euxassay_000237_08 euxassay_000237_09 euxassay_000237_10
EMAGE:31299 EMAGE:31299 EMAGE:31299 EMAGE:31299 EMAGE:31299
euxassay_000237_11 euxassay_000237_12 euxassay_000237_13 euxassay_000237_14 euxassay_000237_15
EMAGE:31299 EMAGE:31299 EMAGE:31299 EMAGE:31299 EMAGE:31299
euxassay_000237_16 euxassay_000237_17 euxassay_000237_18 euxassay_000237_19 euxassay_000237_20
EMAGE:31299 EMAGE:31299 EMAGE:31299 EMAGE:31299
euxassay_000237_21 euxassay_000237_22 euxassay_000237_23 euxassay_000237_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 04
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 07 08 09 18 19 20
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 18 19 20 21 22 23
tail dorsal root ganglion
weak weak
regionalweak expression: see section 08 09 10 11 12 14 15 16 17 18 19 20 21 22
hindgut
strong strong
regionalstrong expression: see section 15 16 17 18 19
foregut-midgut junction
strong strong
regionalstrong expression: see section 14 15 16 17 18 19 20 21 22
anal canal
moderate moderate
regionalmoderate expression: see section 19
stomach
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10
nasal septum
moderate moderate
regionalmoderate expression: see section 07 08 10 11 12 15 16 17 18 19 20
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07
midgut
strong strong
regionalstrong expression: see section 14 15 16 17 18 19 20 21 22 23 moderate expression: see section 24
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T208
Entity Detected:Abhd11, abhydrolase domain containing 11 ( MGI:1916008)
Sequence:sense strand is shown

>T208
GTGGGCATGCTCCGCTGGGCGCGAGCGTGGAGGGTCCCCCGTGGGGTACTCGGTGCCTCCTCTCCCAGGC
GTTTGGCGGTTCCTGTCACGTTCTGTAGCAGCCGCAGTAGTGGCCAAGAAAACGCCGATCTGAGGTCAGC
CAAGGGCACTGGGAGGGTTGTTCTCCACTGGTCCACTTCGCACGCGGCTTAGCTGGCCCCGCCTCTCCTT
TGGCCTCGCCCCTTTTTTCTTTCACTCTCTCCTCCCCCTTACTCCATGGTGGCCCCCACCTTCCAGGCCG
CTGCCGCTGTCTTATAATCTTCTAGATGGAGACGCGACACTCCCAGCCATCGTCTTTTTGCATGGGCTCT
TCGGCAGCAAAACCAACTTCAACTCCCTCGCCAAGGCAATGGTTCAGAGGACTGGCCGGAGGGTGCTGAC
GGTGGATGCCCGGAACCACGGTGACAGCCCCCACAGTCCAGACGCAAGCTATGAG
Notes:The probe template was PCR amplified from IMAGE:2648746 using vector specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2648746 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000237 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS