Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31307

D130079A08Rik ( MGI:2444500)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31307 EMAGE:31307 EMAGE:31307 EMAGE:31307 EMAGE:31307
euxassay_012207_01 euxassay_012207_02 euxassay_012207_03 euxassay_012207_04 euxassay_012207_05
EMAGE:31307 EMAGE:31307 EMAGE:31307 EMAGE:31307 EMAGE:31307
euxassay_012207_06 euxassay_012207_08 euxassay_012207_09 euxassay_012207_10 euxassay_012207_11
EMAGE:31307 EMAGE:31307 EMAGE:31307 EMAGE:31307 EMAGE:31307
euxassay_012207_12 euxassay_012207_13 euxassay_012207_14 euxassay_012207_15 euxassay_012207_16
EMAGE:31307 EMAGE:31307 EMAGE:31307 EMAGE:31307 EMAGE:31307
euxassay_012207_17 euxassay_012207_18 euxassay_012207_19 euxassay_012207_20 euxassay_012207_21
EMAGE:31307
euxassay_012207_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
moderate moderate
single cellmoderate expression: see section 08 09 14 15 16 weak expression: see section 10 13
medulla oblongata basal plate mantle layer
strong strong
single cellstrong expression: see section 16 weak expression: see section 12
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 03 04 05 15 16 18 weak expression: see section 06 07 17 19 20
nasal cavity olfactory epithelium
moderate moderate
single cellmoderate expression: see section 08
midbrain mantle layer
strong strong
regionalstrong expression: see section 10 11 14 15 moderate expression: see section 09 12 13 weak expression: see section 08 16
intermediate grey horn
weak weak
single cellweak expression: see section 11 12 13 14 15
thalamus mantle layer
moderate moderate
regionalmoderate expression: see section 10 12
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37650
Entity Detected:D130079A08Rik, ( MGI:2444500)
Sequence:sense strand is shown

>T37650
GTCAATGTACAACTTCAGGCCAAGGGCTAAGGATCACTGTGCCAATAGTTCAATCACCACATTAGATCAT
TTTAAATGTTTCTCAGCGACACCCAGGTTCTTTCTTTCCCTGGTTATTAAAAGAAGTAAGAAATGTTTTT
TTTTCTTCATTAAAAATTTTCATGTCTATGGTGTTGTAGATGCATGAATGTTCATGTACCGCATGCATGC
CGCATACCTCTAGAGAGCAGAAGAGGGCATCAGGCCCCCTGGGACTGGAGTTATAGATGGTTGAGAGCCA
CCATGTGGCTGCTGGAAAAGAGCCAGGTCCCCCGGAAAAAGCAAGCCAGTGCTCTTAGCTGTGCAGCCAT
CTCTCTGGCCACCAAGGAATGTTTCTTTGAACATACCACATAAAATACACAGTTTGCGTTTAATCTGTAA
TCTTAAGTCAGATGAGGTTGGTGACTTGGTGAGTTACCAAGTCATAGATGAGTGAGAATATTCATTCCAA
AAACTGCTTTTCTTTCACTGTTGTAGGACTGAAAATACTGAAATAATTAAGCACCAAAATCAGAGAAGTG
ACA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 69772. Forward Primer - name:069772_F_cDNA_D130079A08Rik, sequence:GTCAATGTACAACTTCAGGCCA; Reverse Primer - name:069772_N_SP6_cDNA_D130079A08Rik, sequence:TGTCACTTCTCTGATTTTGGTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_012207 same experiment
 EMAGE:32174 same embryo
 EMAGE:30758 same embryo
 EMAGE:32175 same embryo
 EMAGE:31305 same embryo
 EMAGE:29457 same embryo
 EMAGE:31304 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS