Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31308

Snx22 ( MGI:2685966)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31308 EMAGE:31308 EMAGE:31308 EMAGE:31308 EMAGE:31308
euxassay_013779_01 euxassay_013779_02 euxassay_013779_03 euxassay_013779_04 euxassay_013779_05
EMAGE:31308 EMAGE:31308 EMAGE:31308 EMAGE:31308 EMAGE:31308
euxassay_013779_06 euxassay_013779_07 euxassay_013779_08 euxassay_013779_09 euxassay_013779_10
EMAGE:31308 EMAGE:31308 EMAGE:31308 EMAGE:31308 EMAGE:31308
euxassay_013779_11 euxassay_013779_12 euxassay_013779_13 euxassay_013779_14 euxassay_013779_15
EMAGE:31308 EMAGE:31308 EMAGE:31308 EMAGE:31308 EMAGE:31308
euxassay_013779_16 euxassay_013779_17 euxassay_013779_18 euxassay_013779_19 euxassay_013779_20
EMAGE:31308 EMAGE:31308
euxassay_013779_21 euxassay_013779_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
utricle
moderate moderate
regionalmoderate expression: see section 04 05 06 07 19 20 21
liver
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 08 09 10 12 13 14 15 16 17 18 19 20 21 22
right lung
moderate moderate
regionalmoderate expression: see section 14 15 16 17 18 19 20 21 22
left lung
moderate moderate
regionalmoderate expression: see section 04 05 06 08 09 10 12 13
cochlea
moderate moderate
regionalmoderate expression: see section 06 07 08 17 18 19
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37872
Entity Detected:Snx22, ( MGI:2685966)
Sequence:sense strand is shown

>T37872
GTTCCAAGTGGAGGTGCTGTACAGCGGACGCAGACACACCGTGCCGCGGCGCTACAGCGAGTTCCACGCT
CTACACAAGCGGATCAAGAAACGGTACAAAGTGCCTGACTTTCCCTCAAAACGCCTGCCCAACTGGAGGA
CCAGAGGACTGGAACAGCGCCGGCAGGGATTAGAGACCTACATCCAGGGCATCCTGTACCTGAATCAGGA
TGTGCCCAAGGAGTTACTGGAATTCTTGAGACTTAGACATTTCCCTACAGACTCCAAGACCAGCAGCTGG
AGCACCCTGGGGGAATTCCTGCCTAGTGACACCAGCTCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 82026. Forward Primer - name:082026_F_cDNA_LOC382083, sequence:GTTCCAAGTGGAGGTGCTGTA; Reverse Primer - name:082026_N_SP6_cDNA_LOC382083, sequence:GGAGCTGGTGTCACTAGGCA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_013779 same experiment
 EMAGE:29637 same embryo
 EMAGE:29639 same embryo
 EMAGE:30271 same embryo
 EMAGE:29642 same embryo
 EMAGE:30304 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS