Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31310

Stambpl1 STAM binding protein like 1 ( MGI:1923880)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31310 EMAGE:31310 EMAGE:31310 EMAGE:31310 EMAGE:31310
euxassay_002893_01 euxassay_002893_02 euxassay_002893_03 euxassay_002893_04 euxassay_002893_05
EMAGE:31310 EMAGE:31310 EMAGE:31310 EMAGE:31310 EMAGE:31310
euxassay_002893_06 euxassay_002893_07 euxassay_002893_08 euxassay_002893_09 euxassay_002893_10
EMAGE:31310 EMAGE:31310 EMAGE:31310 EMAGE:31310 EMAGE:31310
euxassay_002893_11 euxassay_002893_12 euxassay_002893_13 euxassay_002893_14 euxassay_002893_15
EMAGE:31310 EMAGE:31310 EMAGE:31310 EMAGE:31310 EMAGE:31310
euxassay_002893_16 euxassay_002893_17 euxassay_002893_18 euxassay_002893_19 euxassay_002893_20
EMAGE:31310 EMAGE:31310 EMAGE:31310
euxassay_002893_21 euxassay_002893_22 euxassay_002893_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
interdigital region between hindlimb digits 2 and 3 mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 18 19 20 21
metencephalon basal plate
moderate moderate
regionalmoderate expression: see section 06 16
ventral grey horn
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15
interdigital region between hindlimb digits 3 and 4 mesenchyme
moderate moderate
regionalmoderate expression: see section 02 03 17 18 21
stomach
moderate moderate
regionalmoderate expression: see section 06 07 weak expression: see section 08
interdigital region between hindlimb digits 1 and 2 mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 18 19 20 21 22 23
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 16 17
interdigital region between hindlimb digits 4 and 5 mesenchyme
moderate moderate
regionalmoderate expression: see section 03 17 18
midgut
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 16 17 weak expression: see section 07 08 09 10 11 15
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 04 18 19 20
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 16 weak expression: see section 05 07 08 15 17
medulla oblongata basal plate
moderate moderate
regionalmoderate expression: see section 09 14 weak expression: see section 08 15
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 15 16 17 18 19 20 21
hindgut
moderate moderate
regionalmoderate expression: see section 13 14 15
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 08 12 13
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 08 09 10 13
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2309
Entity Detected:Stambpl1, STAM binding protein like 1 ( MGI:1923880)
Sequence:sense strand is shown

>T2309
TGGCCTCGAGGCCAGATTCGATCCTTGGTCGCAGTCGTCATCCCACACAAGCTCCGGACGCGCACGACTG
CTGGTGAGTGGCCCCACACGTGTGCCCGCTGGCCCCGAGATGAAGTGACTGAGAAGGAGTGAGCACCTTG
CCTTTGCAGACAGGACAGCATGGAGCAGCCATTCACTGTGAATTCACTGAAAAAGTTAGCTGCTATGCCT
GACCATACAGATGTTTCTCTAAGTCCAGAGGAGCGGGTCCGCGCCCTAAGCAAACTTGGTTGTAATATCT
CCATTAATGAAGATATCACCCCACGCCGTTACTTCAGGTCCGGAGTGGAAATGGAAAGGATGGCATCTGT
GTATTTGGAAGAAGGAAACCTGGAAAATGCCTTTGTTCTTTATAACAAATTTATAACGTTATTTGTAGAA
AAACTTCCCAGCCACCGAGATTACCAGCAGTGTGCAGTTCCAGAGAAGCAGGATATTATGAAGAAACTGA
AGGAGATTGCGTTCCCAAGGACAGACGAATTGAAAACGGACCTGCTAAGGAAATATAACATAGAATACCA
AGAGTATTTGC
Notes:The probe template was PCR amplified from IMAGE:1138874 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1138874 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002893 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS