Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31313

D5Ertd593e ( MGI:1261768)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31313 EMAGE:31313 EMAGE:31313 EMAGE:31313 EMAGE:31313
euxassay_000472_01 euxassay_000472_02 euxassay_000472_03 euxassay_000472_04 euxassay_000472_05
EMAGE:31313 EMAGE:31313 EMAGE:31313 EMAGE:31313 EMAGE:31313
euxassay_000472_06 euxassay_000472_07 euxassay_000472_08 euxassay_000472_09 euxassay_000472_10
EMAGE:31313 EMAGE:31313 EMAGE:31313 EMAGE:31313 EMAGE:31313
euxassay_000472_11 euxassay_000472_12 euxassay_000472_13 euxassay_000472_14 euxassay_000472_15
EMAGE:31313 EMAGE:31313 EMAGE:31313 EMAGE:31313 EMAGE:31313
euxassay_000472_16 euxassay_000472_17 euxassay_000472_18 euxassay_000472_19 euxassay_000472_20
EMAGE:31313 EMAGE:31313 EMAGE:31313
euxassay_000472_21 euxassay_000472_22 euxassay_000472_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
diaphragm
weak weak
regionalweak expression: see section 03 04 05 09 10 11 12 13 14 20 21 22 23
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 22 23 weak expression: see section 04 11 12
lower jaw molar
weak weak
regionalweak expression: see section 13 14 16 20 21
upper jaw molar
weak weak
regionalweak expression: see section 13 14 16 20 21
ventral grey horn
weak weak
regionalweak expression: see section 02 15
chondrocranium
weak weak
regionalweak expression: see section 04 10 11 12 20 22 23
nasal capsule
weak weak
regionalweak expression: see section 01 02 08 14 15 16 17 18 20 21
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3813
Entity Detected:D5Ertd593e, ( MGI:1261768)
Sequence:sense strand is shown

>T3813
TGGCCTCGAGGCCAGATTCGGCACGAGGNNTCAGCCCTGCTGGTCGGCGGGGGTCTAGCTGGAGCGCTCA
TCCTGTGGCTGCTGCGGGGAGACTCTGGGGCCCCGGGGAAAGACGGGGTTGCGGAGCCGCCGCAGAAGGG
CGCACCTCCTGGGGAGGCTGCGGCCCCGGGAGACGGTCCGGGTGGTGGTGGCAGTGGCGGCCTGAGCCCT
GAACCTTCCGATCGGGAGCTGGTCTCCAAAGCAGAGCATCTTCGAGAAAGCAACGGACATTTGATTTCTG
AGAGCAAAGATCTTGGTAACCTGCCGGAAGCACAGCGGCTGCAGAATGTTGGAGCAGACTGGGTCAATGC
CAGAGAGTTTGTTCCTGTTGGGAAGATTCCAGACACACACTCCAGGGCCGACTCTGAAGCGGCAAGAAAT
CAAAGCCCAGGATCTCATGGAGGAGAATGGAGACTCCCCAAAGGACAAGAAACAGCTGTCAAAGTAGCTG
GCAGTGTGGCCGCAAAGCTGCCCTCCAGCAGCCTGCTTGTGGACAGAGCTA
Notes:The probe template was PCR amplified from IMAGE:404084 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:404084 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000472 same experiment
 EMAGE:29706 same embryo
 EMAGE:30053 same embryo
 EMAGE:31300 same embryo
 EMAGE:29723 same embryo
 EMAGE:29646 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS