Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31323

AI854517 ( MGI:2142071)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31323 EMAGE:31323 EMAGE:31323 EMAGE:31323 EMAGE:31323
euxassay_016239_01 euxassay_016239_02 euxassay_016239_03 euxassay_016239_04 euxassay_016239_05
EMAGE:31323 EMAGE:31323 EMAGE:31323 EMAGE:31323 EMAGE:31323
euxassay_016239_06 euxassay_016239_07 euxassay_016239_08 euxassay_016239_09 euxassay_016239_10
EMAGE:31323 EMAGE:31323 EMAGE:31323 EMAGE:31323 EMAGE:31323
euxassay_016239_11 euxassay_016239_12 euxassay_016239_13 euxassay_016239_14 euxassay_016239_15
EMAGE:31323 EMAGE:31323 EMAGE:31323 EMAGE:31323 EMAGE:31323
euxassay_016239_16 euxassay_016239_17 euxassay_016239_18 euxassay_016239_19 euxassay_016239_20
EMAGE:31323 EMAGE:31323 EMAGE:31323 EMAGE:31323 EMAGE:31323
euxassay_016239_21 euxassay_016239_22 euxassay_016239_23 euxassay_016239_24 euxassay_016239_25

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
midbrain ventricular layer
weak weak
regionalweak expression: see section 09 10 11 13 14
hypothalamus ventricular layer
weak weak
regionalweak expression: see section 13 14
medulla oblongata basal plate ventricular layer
weak weak
regionalweak expression: see section 13 14
pons ventricular layer
weak weak
regionalweak expression: see section 09 10 11 13 14
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 13 14
spinal cord ventricular layer
weak weak
regionalweak expression: see section 13 14
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39353
Entity Detected:AI854517, ( MGI:2142071)
Sequence:sense strand is shown

>T39353
CTTAAAGGTCAGTTACGGTGGCAGGGGTGTGTGAAGCTCAGTGGTAAAATGCACACAGCATACAGGAGGC
CTAGAGCCAAAAAACCCTGTATCAACCATAAGTATGTCTGCATGAATGGTTGGCAAGCAAGCCCTGCCCA
GCAGCCTCCAGGAAGCAGGAGGCCTTTCCTCCTGTGTCTTTGTGTTTGTTTTCTCTCTGCGTTTGTGAAG
CACTTTTATTGAAAAAAAGAAAGGATAGTAATCACTTAATAGGTGTAACTTCTCTCAGCCAACGAAGGGC
ATGCACTCCAAGACAAGGTGGTGATGTGGCTGAGAAGTGTCTTGACAGTACTGGTGGCCTCTGGCCACTG
GCGGTTCTCCAACCACATGTCATCATCATGACTGCCACTGTTAATCGAAAGCCCACTTAGTCCCAGGGTT
AGTTCTCTGGTTCCTGCTTAGGTGAGTGTCCTAGTATTTCAGTCTAGCCAATGCAGGAGACTGAATGGGG
AAATCAGTGGGTTTCTCCAAGCTGTTTGGGTCAAGTCAGTATCCTAGAGTGGGTAAGGCAAGTGTGGGCT
CTGATTTCCCTCTGGGAGGACCTGTTTTGAGGAGGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 80513. Forward Primer - name:080513_F_cDNA_AI854517, sequence:CTTAAAGGTCAGTTACGGTGGC; Reverse Primer - name:080513_N_SP6_cDNA_AI854517, sequence:CCCTCCTCAAAACAGGTCCT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_016239 same experiment
 EMAGE:30932 same embryo
 EMAGE:29262 same embryo
 EMAGE:29264 same embryo
 EMAGE:29267 same embryo
 EMAGE:29248 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS