Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31361

Plscr2 ( MGI:1270860)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31361 EMAGE:31361 EMAGE:31361 EMAGE:31361 EMAGE:31361
euxassay_007760_01 euxassay_007760_02 euxassay_007760_03 euxassay_007760_04 euxassay_007760_05
EMAGE:31361 EMAGE:31361 EMAGE:31361 EMAGE:31361 EMAGE:31361
euxassay_007760_06 euxassay_007760_07 euxassay_007760_08 euxassay_007760_09 euxassay_007760_10
EMAGE:31361 EMAGE:31361 EMAGE:31361 EMAGE:31361 EMAGE:31361
euxassay_007760_11 euxassay_007760_12 euxassay_007760_13 euxassay_007760_14 euxassay_007760_15
EMAGE:31361 EMAGE:31361 EMAGE:31361 EMAGE:31361 EMAGE:31361
euxassay_007760_16 euxassay_007760_17 euxassay_007760_18 euxassay_007760_19 euxassay_007760_20
EMAGE:31361 EMAGE:31361
euxassay_007760_21 euxassay_007760_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
inner ear
strong strong
regionalstrong expression: see section 04 05 06 18
mesothelium
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
pericardial cavity
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
urogenital mesentery
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
tongue muscle
strong strong
regionalstrong expression: see section 08 09 10 11
thyroid gland
strong strong
regionalstrong expression: see section 10 11 12 13 14
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1414
Entity Detected:Plscr2, ( MGI:1270860)
Sequence:sense strand is shown

>T1414
TCTCNAGCCTGTTGGCCTACTGGAGATATTCATTTCTACTGAGAGCCTCTGCCAGGAGCAGCTAACAATT
CTCAAAGGACTTAGAACTCAGACAGGGTTTCAATTTGGTTGCGTATCTTTCCAGTCAGGAAAAGGAAATC
TAAAGACTCAGGAAACAAAACCTAAACTGCCTCAAAGTCCAGGTGCTTTTTCTCCCTGACTTTAGTCTAG
TGGAGTAGTGCAGCACCTATGCCTTTCTGAGAGGAGTCTGGAGAGCTGAGTCGCTGCTGGTGCTAGGATT
CTAGGAATTCGCCTCACTTGGAGCTGCATGAGAAAGGCTTGCAAATGGAGGCTCCTCGCTCAGGAACATA
CTTGCCAGCTGGGTATGCCCCTCAGTATCCTCCAGCAGCAGTCCAAGGACCTCCAGAGCATACTGGACGC
CCCACATTCCAGACTAACTACCAAGTTCCCCAGTCTGGTTATCCAGGACCTCAGGCTAGCTACACAGTCT
CAACATCTGGACATGAAGGTTATGCTGCTACACGGCTTCCTATTCAAAATAATCAGACTATAGTCCTTGC
AAA
Notes:The probe template was PCR amplified from IMAGE:2373235 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2373235 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_007760 same experiment
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS