Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31365

Dtymk deoxythymidylate kinase ( MGI:108396)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31365 EMAGE:31365 EMAGE:31365 EMAGE:31365 EMAGE:31365
euxassay_003137_01 euxassay_003137_02 euxassay_003137_03 euxassay_003137_04 euxassay_003137_05
EMAGE:31365 EMAGE:31365 EMAGE:31365 EMAGE:31365 EMAGE:31365
euxassay_003137_06 euxassay_003137_07 euxassay_003137_08 euxassay_003137_09 euxassay_003137_10
EMAGE:31365 EMAGE:31365 EMAGE:31365 EMAGE:31365 EMAGE:31365
euxassay_003137_11 euxassay_003137_12 euxassay_003137_13 euxassay_003137_14 euxassay_003137_15
EMAGE:31365 EMAGE:31365 EMAGE:31365 EMAGE:31365 EMAGE:31365
euxassay_003137_16 euxassay_003137_17 euxassay_003137_18 euxassay_003137_19 euxassay_003137_20
EMAGE:31365 EMAGE:31365 EMAGE:31365 EMAGE:31365
euxassay_003137_21 euxassay_003137_22 euxassay_003137_23 euxassay_003137_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
strong strong
regionalstrong expression: see section 08 09 10 11 18 19 20 moderate expression: see section 21 22
thymus primordium
weak weak
homogeneousweak expression: see section 12 13 14 15 16 17
telencephalon ventricular layer
moderate moderate
homogeneousmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
olfactory cortex ventricular layer
moderate moderate
homogeneousmoderate expression: see section 13 14 18 19 20
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 13 14 15 18 19
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 14 15 18 19 20
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T4675
Entity Detected:Dtymk, deoxythymidylate kinase ( MGI:108396)
Sequence:sense strand is shown

>T4675
GGGCTTCCGTGCACGCCGGGCTTCTGCTGCATCTAACATTGGCGGGAACCTGGCAAGTTGACCGGTGCTG
TGCGGGCGATGGCGTCGCGTCGGGGAGCGCTCATCGTGCTGGAGGGTGTGGACCGTGCTGGCAAGACCAC
GCAGGGCCTCAAGCTGGTGACCGCGCTGTGCGCCTCGGGCCACAGAGCGGAGCTGCTGCGTTTCCCCGAA
AGATCAACGGAAATCGGCAAGCTTCTGAATTCCTACTTGGAAAAGAAAACGGAACTAGAGGATCACTCCG
TGCACCTGCTCTTCTCTGCAAACCGCTGGGAACAAGTGTAAAGACCTGCGTCGTTGCTCCCCGGTTGTAA
CATGCACACTTTTGTGTGTGGCAAGGGTGCGAGCACCTGTGTGTGGCATGTGTGCAAACACCCGCACGTC
GAGACCAGAGGCCAGCTTGGGAGGTTTCCTCTACCCTACCATTCGACGCCGTATTTGAGATAAAAAAATC
GACGTATTTGAGATAAAAAATCGTCGTATTTGAGATAAAAAATCGCCGTATTTGAGATAAAACATCGTCG
TATTTGACCATCGTATTTAACCACATCCGGCTTGTTTTGTTTTATTAAAAGGTTTTTTTTTTGAAAAAAA
AAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:5026527 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:5026527 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_003137 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS