Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31407

Snurf ( MGI:1891236)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31407 EMAGE:31407 EMAGE:31407 EMAGE:31407 EMAGE:31407
euxassay_014492_01 euxassay_014492_02 euxassay_014492_03 euxassay_014492_04 euxassay_014492_05
EMAGE:31407 EMAGE:31407 EMAGE:31407 EMAGE:31407 EMAGE:31407
euxassay_014492_06 euxassay_014492_07 euxassay_014492_08 euxassay_014492_09 euxassay_014492_10
EMAGE:31407 EMAGE:31407 EMAGE:31407 EMAGE:31407 EMAGE:31407
euxassay_014492_11 euxassay_014492_12 euxassay_014492_13 euxassay_014492_14 euxassay_014492_15
EMAGE:31407 EMAGE:31407 EMAGE:31407 EMAGE:31407 EMAGE:31407
euxassay_014492_16 euxassay_014492_17 euxassay_014492_18 euxassay_014492_19 euxassay_014492_20
EMAGE:31407 EMAGE:31407 EMAGE:31407
euxassay_014492_21 euxassay_014492_22 euxassay_014492_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
neural retina
moderate moderate
regionalmoderate expression: see section 02 03 04 21 22 23
ventral grey horn
strong strong
homogeneousstrong expression: see section 06 07 08 09 10 11 12
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 16 weak expression: see section 06 07
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 08 13
rest of cerebellum mantle layer
strong strong
homogeneousstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
medulla oblongata alar plate mantle layer
strong strong
homogeneousstrong expression: see section 06 07 08 09 12 13 14 15
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 06 moderate expression: see section 16
trigeminal v nerve
strong strong
regionalstrong expression: see section 09
thoracic ganglion
weak weak
regionalweak expression: see section 09 10
pons mantle layer
strong strong
homogeneousstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16
dorsal root ganglion
strong strong
regionalstrong expression: see section 05 06 07 11 12 13 14 15 moderate expression: see section 08
medulla oblongata basal plate mantle layer
strong strong
homogeneousstrong expression: see section 06 07 08 09 10 11 12 13 14 15
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 17 18 19
vagus x ganglion
strong strong
regionalstrong expression: see section 07 15
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 16 17 18 19 20
midbrain marginal layer
strong strong
homogeneousstrong expression: see section 06
cervical ganglion
weak weak
regionalweak expression: see section 08 14
telencephalon mantle layer
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
midbrain mantle layer
strong strong
homogeneousstrong expression: see section 05 07 08 09 10 11 12 13 14 15 16 17
diencephalon lateral wall mantle layer
strong strong
homogeneousstrong expression: see section 07 08 09 10 11 12 13 14 15 16
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38015
Entity Detected:Snurf, ( MGI:1891236)
Sequence:sense strand is shown

>T38015
GCTTGGTTCTGAGGAGTGATTTGCAACGCAATGGAGCGAGGAAGGGATCGCTTACACTTGAGAAGAACTA
CTGAACAGCACGTGCCCGAGGTCGAGGTCCAGGTCAAACGTCGAAGGACAGCCTCACTGAGCAACCAAGA
GTGTCACTTGTACCCACGACGTTCTCAGCAACAGCAAGTTCCTGTGGTGGATTTCCAGGCAGAACTAAGA
CAGGCATTCTTAGCTGAGACACCAAGAGGTGGTTAAAGCAGTATTGCAACTTCAAGGTGGTGGAATTCAA
GGAAAACAGGACCCATCCTCTGTCTGTAAACTTTGGTCAAGCTTACATTGTTTGTTAATAGCCCTGCATC
GAACCTTTATTT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 88451. Forward Primer - name:088451_F_cDNA_Snurf, sequence:GCTTGGTTCTGAGGAGTGATTT; Reverse Primer - name:088451_N_SP6_cDNA_Snurf, sequence:AAATAAAGGTTCGATGCAGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_014492 same experiment
 EMAGE:29517 same embryo
 EMAGE:29516 same embryo
 EMAGE:31409 same embryo
 EMAGE:29512 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS