Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31427

Cops5 COP9 (constitutive photomorphogenic) homolog, subunit 5 (Arabidopsis thaliana) ( MGI:1349415)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31427 EMAGE:31427 EMAGE:31427 EMAGE:31427 EMAGE:31427
euxassay_012062_01 euxassay_012062_02 euxassay_012062_03 euxassay_012062_04 euxassay_012062_05
EMAGE:31427 EMAGE:31427 EMAGE:31427 EMAGE:31427 EMAGE:31427
euxassay_012062_06 euxassay_012062_07 euxassay_012062_08 euxassay_012062_09 euxassay_012062_10
EMAGE:31427 EMAGE:31427 EMAGE:31427 EMAGE:31427 EMAGE:31427
euxassay_012062_11 euxassay_012062_12 euxassay_012062_13 euxassay_012062_14 euxassay_012062_15
EMAGE:31427 EMAGE:31427 EMAGE:31427 EMAGE:31427 EMAGE:31427
euxassay_012062_16 euxassay_012062_17 euxassay_012062_18 euxassay_012062_19 euxassay_012062_20
EMAGE:31427 EMAGE:31427 EMAGE:31427 EMAGE:31427
euxassay_012062_21 euxassay_012062_22 euxassay_012062_23 euxassay_012062_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
weak weak
regionalweak expression: see section 07 08 09 10 15 16
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 08 09 15 16
facial vii ganglion
weak weak
regionalweak expression: see section 06
vagus x ganglion
weak weak
regionalweak expression: see section 08
trigeminal v ganglion
weak weak
regionalweak expression: see section 04 05 06 07 08 09 17 18 19 20 21
ventral grey horn
weak weak
regionalweak expression: see section 09 10 13 14
temporal bone
weak weak
regionalweak expression: see section 19 20 21 22
exoccipital bone
weak weak
regionalweak expression: see section 18 19 20 21 22
orbito-sphenoid
weak weak
regionalweak expression: see section 06 07 09 20 21 22
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 07 17
viscerocranium
weak weak
regionalweak expression: see section 09 10 11 20 21
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36183
Entity Detected:Cops5, COP9 (constitutive photomorphogenic) homolog, subunit 5 (Arabidopsis thaliana) ( MGI:1349415)
Sequence:sense strand is shown

>T36183
TCAAGCTGCTGCGTATGAGTATATGGCTGCATACATAGAAAATGCCAAACAGGTTGGCCGCCTTGAGAAT
GCAATCGGTTGGTATCATAGCCACCCTGGTTATGGCTGCTGGCTCTCCGGGATTGATGTTAGTACACAGA
TGCTGAACCAGCAGTTTCAAGAACCATTTGTAGCAGTGGTGATTGATCCAACCAGAACAATCTCTGCAGG
AAAAGTGAATCTTGGCGCCTTTAGGACATATCCAAAGGGCTACAAACCTCCTGATGAAGGACCTTCTGAG
TACCAGACTATCCCACTTAATAAAATAGAAGATTTTGGCGTGCACTGCAAACAATATTATGCCTTAGAAG
TCTCATATTTCAAATCATCTTTGGATCGTAAACTACTTGAGCTTTTGTGGAATAAATACTGGGTGAATAC
CCTGAGTTCCTCTAGCTTGCTTACTAATGCAGACTACACCACAGGCCAGGTGTTTGATTTGTCTGAGAAG
TTAGAGCAGTCGGAAGCCCAACTGGGACGTGGCAGTTTCATGTTGGGCTTAGAAACACATGACCGCAAGT
CGGAAGACAAACTTGCCAAAGCTACTAGAGACAGCTGTAAAACCACCATAGAAGCCATCCATGGACTGAT
GTCTCAGGTTATTAAGGATAAACTGTTTAATCAGATTAACGTTGCTTAGTTACCACCAAGTACTTCTCAA
AGCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 99884. Forward Primer - name:099884_F_cDNA_Cops5, sequence:TCAAGCTGCTGCGTATGAGTAT; Reverse Primer - name:099884_N_SP6_cDNA_Cops5, sequence:AGCTTTGAGAAGTACTTGGTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_012062 same experiment
 EMAGE:31429 same embryo
 EMAGE:31428 same embryo
 EMAGE:31431 same embryo
 EMAGE:31430 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS