Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31429

Hbq1 ( MGI:2685722)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31429 EMAGE:31429 EMAGE:31429 EMAGE:31429 EMAGE:31429
euxassay_012064_01 euxassay_012064_02 euxassay_012064_03 euxassay_012064_04 euxassay_012064_05
EMAGE:31429 EMAGE:31429 EMAGE:31429 EMAGE:31429 EMAGE:31429
euxassay_012064_06 euxassay_012064_07 euxassay_012064_08 euxassay_012064_09 euxassay_012064_10
EMAGE:31429 EMAGE:31429 EMAGE:31429 EMAGE:31429 EMAGE:31429
euxassay_012064_11 euxassay_012064_12 euxassay_012064_13 euxassay_012064_14 euxassay_012064_15
EMAGE:31429 EMAGE:31429 EMAGE:31429 EMAGE:31429 EMAGE:31429
euxassay_012064_16 euxassay_012064_17 euxassay_012064_18 euxassay_012064_19 euxassay_012064_20
EMAGE:31429 EMAGE:31429 EMAGE:31429 EMAGE:31429
euxassay_012064_21 euxassay_012064_22 euxassay_012064_23 euxassay_012064_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
liver lobe
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36464
Entity Detected:Hbq1, ( MGI:2685722)
Sequence:sense strand is shown

>T36464
AGGCTCAGTTCATTGAAGATGGCTCGGTCCCAGGATGATCAGTGGCTGGTCCTTGCGCTCTGGAAGAAGA
TGGGCAGCAATGTCGGAATCTACACGACCGAGGCCTTGGAGAGGACCTTCGTGGCTTTCCCCTCCACCAA
AACCTACTTCCCACACTTGGACCTGAGGCCAGGCTCTAGCCAGGTTAAAGCCCATGCCCAAAAGGTGGCC
GATGCACTGACTCTCGCTACCCAGCACCTGGACGACCTGCCTGCTTCTCTGTCTGCTCTCAGTGATCTAC
ATGCGCACAAGCTCTGTGTGGACCCTGCTAACTTCCAGTTCTTCAGCTGCTGTCTGCTGGTGACTCTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 88391. Forward Primer - name:088391_F_cDNA_Hbq1, sequence:AGGCTCAGTTCATTGAAGATGG; Reverse Primer - name:088391_N_SP6_cDNA_Hbq1, sequence:GAGAGTCACCAGCAGACAGC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_012064 same experiment
 EMAGE:31428 same embryo
 EMAGE:31427 same embryo
 EMAGE:31431 same embryo
 EMAGE:31430 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS