Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31430

Gm166 ( MGI:2685012)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31430 EMAGE:31430 EMAGE:31430 EMAGE:31430 EMAGE:31430
euxassay_012063_01 euxassay_012063_02 euxassay_012063_03 euxassay_012063_04 euxassay_012063_05
EMAGE:31430 EMAGE:31430 EMAGE:31430 EMAGE:31430 EMAGE:31430
euxassay_012063_06 euxassay_012063_07 euxassay_012063_08 euxassay_012063_09 euxassay_012063_10
EMAGE:31430 EMAGE:31430 EMAGE:31430 EMAGE:31430 EMAGE:31430
euxassay_012063_11 euxassay_012063_12 euxassay_012063_13 euxassay_012063_14 euxassay_012063_15
EMAGE:31430 EMAGE:31430 EMAGE:31430 EMAGE:31430 EMAGE:31430
euxassay_012063_16 euxassay_012063_17 euxassay_012063_18 euxassay_012063_19 euxassay_012063_20
EMAGE:31430 EMAGE:31430 EMAGE:31430 EMAGE:31430
euxassay_012063_21 euxassay_012063_22 euxassay_012063_23 euxassay_012063_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
temporal bone
strong strong
regionalstrong expression: see section 01 02 03 04 21 22 23 moderate expression: see section 19 20
humerus
strong strong
regionalstrong expression: see section 01 02 03 04 21 22 23 24 weak expression: see section 20
fibula
strong strong
regionalstrong expression: see section 01 04
pelvic girdle skeleton
strong strong
regionalstrong expression: see section 08 09 16
rib
strong strong
regionalstrong expression: see section 01 02 moderate expression: see section 05 06 07 16 21 22 23 weak expression: see section 03 04 17 18 19 20 24
axial skeleton
strong strong
regionalstrong expression: see section 06 07 08 09 moderate expression: see section 10 11 12 13 14 15 16
viscerocranium
strong strong
regionalstrong expression: see section 20 23 moderate expression: see section 09 10 11 12
meckel's cartilage
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 15 16 17 18 19 20 21 22
basioccipital bone
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
tibia
strong strong
regionalstrong expression: see section 01 02 03
scapula
strong strong
regionalstrong expression: see section 01 02 03 20 21 22 moderate expression: see section 04
femur
strong strong
regionalstrong expression: see section 02 03 04 05 06 19 20 21 22 moderate expression: see section 07 23 weak expression: see section 18
exoccipital bone
strong strong
regionalstrong expression: see section 02 03 04 05 21 22 23 moderate expression: see section 18 19 20
orbito-sphenoid
strong strong
regionalstrong expression: see section 02 03 04 07 08 20 21 22 24 moderate expression: see section 09 19
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36434
Entity Detected:Gm166, ( MGI:2685012)
Sequence:sense strand is shown

>T36434
CCTTGACTGAGGCTAAGAAGGACGAAGAGATGATTACCCCCAGTTCCAGCCAGAGCCTGGGAATGAAGGT
GCAGATGGAGTCGGAACAATCTCCCAAATTGCAGGAGGAACTGGACAGGAGTCCCAGCTCGGTGGACGGC
TCGGCCATAAGGAACGGAACAGACATGCAGACCGAGTCGCCCGCAGAAGCCACTAGTAGCCCTGTGGAAG
TGGCTGAAGATCCTGGAGCCAACTTGTTCCCGCCACCACTACCCCAGCCCCGGATCTGTATGTGGAAATA
CCTGGACATCCATTCTATGCACAGACTGGAGAAGGCAGCCACTGTGGAAAAGATGAGAGAGGTTCTTGCT
GAGCTCTTGGAGCTTGGCTTTCCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 80753. Forward Primer - name:080753_F_cDNA_Gm166, sequence:CCTTGACTGAGGCTAAGAAGGA; Reverse Primer - name:080753_N_SP6_cDNA_Gm166, sequence:AGGAAAGCCAAGCTCCAAGA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_012063 same experiment
 EMAGE:31429 same embryo
 EMAGE:31428 same embryo
 EMAGE:31427 same embryo
 EMAGE:31431 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS