Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31431

Stk35 ( MGI:1914583)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31431 EMAGE:31431 EMAGE:31431 EMAGE:31431 EMAGE:31431
euxassay_012066_01 euxassay_012066_02 euxassay_012066_03 euxassay_012066_04 euxassay_012066_05
EMAGE:31431 EMAGE:31431 EMAGE:31431 EMAGE:31431 EMAGE:31431
euxassay_012066_06 euxassay_012066_07 euxassay_012066_08 euxassay_012066_09 euxassay_012066_10
EMAGE:31431 EMAGE:31431 EMAGE:31431 EMAGE:31431 EMAGE:31431
euxassay_012066_11 euxassay_012066_12 euxassay_012066_13 euxassay_012066_14 euxassay_012066_15
EMAGE:31431 EMAGE:31431 EMAGE:31431 EMAGE:31431 EMAGE:31431
euxassay_012066_16 euxassay_012066_17 euxassay_012066_18 euxassay_012066_19 euxassay_012066_20
EMAGE:31431 EMAGE:31431 EMAGE:31431 EMAGE:31431
euxassay_012066_21 euxassay_012066_22 euxassay_012066_23 euxassay_012066_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
temporal bone
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 18 19 20 21 22 23
humerus
strong strong
regionalstrong expression: see section 21 22 23 24 moderate expression: see section 01 02 03 weak expression: see section 04 20
fibula
moderate moderate
regionalmoderate expression: see section 01
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 09 15 16 weak expression: see section 08
viscerocranium
moderate moderate
regionalmoderate expression: see section 09 10 11 19 20
otic capsule
moderate moderate
regionalmoderate expression: see section 09 weak expression: see section 08 16
meckel's cartilage
strong strong
regionalstrong expression: see section 05 06 07 09 10 17 18 19 21 moderate expression: see section 03 04 08 11 12 13 15 16 20 weak expression: see section 14 22
basioccipital bone
moderate moderate
regionalmoderate expression: see section 08 09 10 11 13 14 15 16
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14
tibia
moderate moderate
regionalmoderate expression: see section 01 02
scapula
strong strong
regionalstrong expression: see section 21 moderate expression: see section 01 02 03 20
femur
strong strong
regionalstrong expression: see section 05 22 moderate expression: see section 02 03 04 18 19 20 21 23 weak expression: see section 06
exoccipital bone
moderate moderate
regionalmoderate expression: see section 02 03 04 05 17 18 19 20 23
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 07 08 09 19 20 21 22 23 24
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37090
Entity Detected:Stk35, ( MGI:1914583)
Sequence:sense strand is shown

>T37090
CCAGAATATCGTGCAGTTTGAGGAGTGCGTCCTACAGCGCAACGGGTTAGCCCAGCGCATGAGTCACGGC
AACAAGAACTCACAGCTTTACCTGCGCCTGGTGGAGACCTCGCTCAAAGGAGAAAGGATCCTGGGCTATG
CTGAGGAGCCCTGCTATCTCTGGTTTGTCATGGAGTACTGTGAAGGTGGAGACCTCAATCAGTATGTCCT
GTCCCGGAGAGCTGACCCAGCCACCAACAAAAGTGTCATGCTACAGCTTACAAGCGCCATTGCCTTCCTG
CATAAAAACCACATCGTGCACAGGCGACCTAAAGCCAGACAACATCCTGATCACAGAGCGGTCGGCACCC
CCATCCTCAAGGTGGCAGACTTTGGACTGAGCAAGGTCTGTGCAGGGCTGGCACCCCGAGGCAAAGAGGG
CAATCAAGATAACAAAAATGTGAATGTGAATAAATACTGGCTGTCCTCAGCTTGTGGCTCAGACTTCTAC
ATGGCTCCCGAAGTCTGGGAGGGACACTACACAGCCAAGGCGGACATCTTTGCTCTGGGCATTATCATCT
GGGCAATGATAGAAAGAATTACCTTTATTGACTCTGAAACCAAGAAGGAGCTCCTGGGGACCTACATTAA
GCAAGGGACTGAGATCGTCCCTGTTGGTGAGGCGCTGCTAGAAAACCCAAAGATGGAGTTGCATATCCCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 95834. Forward Primer - name:095834_F_cDNA_Stk35, sequence:CCAGAATATCGTGCAGTTTGAG; Reverse Primer - name:095834_N_SP6_cDNA_Stk35, sequence:GGGGATATGCAACTCCATCT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_012066 same experiment
 EMAGE:31429 same embryo
 EMAGE:31428 same embryo
 EMAGE:31427 same embryo
 EMAGE:31430 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS