Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31439

E130201N16Rik ( MGI:1925254)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31439 EMAGE:31439 EMAGE:31439 EMAGE:31439 EMAGE:31439
euxassay_002033_01 euxassay_002033_02 euxassay_002033_03 euxassay_002033_04 euxassay_002033_05
EMAGE:31439 EMAGE:31439 EMAGE:31439 EMAGE:31439 EMAGE:31439
euxassay_002033_06 euxassay_002033_07 euxassay_002033_08 euxassay_002033_09 euxassay_002033_10
EMAGE:31439 EMAGE:31439 EMAGE:31439 EMAGE:31439 EMAGE:31439
euxassay_002033_11 euxassay_002033_12 euxassay_002033_13 euxassay_002033_14 euxassay_002033_15
EMAGE:31439 EMAGE:31439 EMAGE:31439 EMAGE:31439 EMAGE:31439
euxassay_002033_16 euxassay_002033_17 euxassay_002033_18 euxassay_002033_19 euxassay_002033_20
EMAGE:31439 EMAGE:31439 EMAGE:31439 EMAGE:31439
euxassay_002033_21 euxassay_002033_22 euxassay_002033_23 euxassay_002033_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
oral epithelium
strong strong
regionalstrong expression: see section 08 09 10 18 19 moderate expression: see section 11 12 13 14 15
foregut-midgut junction
weak weak
regionalweak expression: see section 14 15 16
pituitary gland
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 06 07 16 17 18 19
stomach
moderate moderate
regionalmoderate expression: see section 01 02 03 04
midgut
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15 16 17
lower jaw molar
strong strong
regionalstrong expression: see section 16
upper jaw molar
strong strong
regionalstrong expression: see section 16
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 13 14 15 16 17 18 moderate expression: see section 02 03 11 19
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 18 19
hindgut
weak weak
regionalweak expression: see section 13 15 16
lower jaw incisor
strong strong
regionalstrong expression: see section 13
upper jaw incisor
strong strong
regionalstrong expression: see section 13
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3475
Entity Detected:E130201N16Rik, ( MGI:1925254)
Sequence:sense strand is shown

>T3475
TGGCCTCGAGCCAGATTCGGACGAGGNTGAAGAAAGGACGCGCCCTAGAATGTGAGACTCCCACCGGGAA
AGGCTGACCAGACTCACCCTGGGGCGGAGGATCTGACAGTCCCTGCCACCTGAGCGGACCGTGCTGCCAA
CCCCAGGTTGTTCCGACAGTGTGCGAGTGTCAGGGGTGTTGGGCGAGATCAGCAACAACGATTCCTGCAT
CTCTCCTAGTCAGCGATAAGGGACACCGCGACTAAGCTTCAGGCACCCGGAGACGCCCCCTCCGTGTTCT
AGACAGCCCGCGCGGCGCAGCGCGGCGCCGCAGTGGCCCTGAAAGCCCCTACAGGGCTCTCCCTCAACTC
CCATCCAGCAAGTCTGCGTGGGAGAAGCCTGGAAGGGCTGGAGTGAAGAGTCAGAGACCACAGAAAAGAG
AGGAGCTGTCCTGGCCCAGGCCCTTCCCCACGCAGGGTGCTTGGCCTATGGGCCATGGCGGACAGTGGCG
GCTCCAGCCCCTGGTGGAAATCTCTGACCAGGAAGAAAAGCAAGGAAGTTACGGTGGGGGTGC
Notes:The probe template was PCR amplified from IMAGE:332374 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:332374 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002033 same experiment
 EMAGE:32032 same embryo
 EMAGE:30990 same embryo
 EMAGE:32036 same embryo
 EMAGE:32038 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS