Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31539

Anks1 ( MGI:2446180)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31539 EMAGE:31539 EMAGE:31539 EMAGE:31539 EMAGE:31539
euxassay_005066_01 euxassay_005066_02 euxassay_005066_03 euxassay_005066_04 euxassay_005066_05
EMAGE:31539 EMAGE:31539 EMAGE:31539 EMAGE:31539 EMAGE:31539
euxassay_005066_06 euxassay_005066_07 euxassay_005066_08 euxassay_005066_09 euxassay_005066_10
EMAGE:31539 EMAGE:31539 EMAGE:31539 EMAGE:31539 EMAGE:31539
euxassay_005066_11 euxassay_005066_12 euxassay_005066_13 euxassay_005066_14 euxassay_005066_15
EMAGE:31539 EMAGE:31539 EMAGE:31539 EMAGE:31539 EMAGE:31539
euxassay_005066_16 euxassay_005066_17 euxassay_005066_18 euxassay_005066_19 euxassay_005066_20
EMAGE:31539 EMAGE:31539
euxassay_005066_21 euxassay_005066_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 13 14 weak expression: see section 07
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 weak expression: see section 05
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 10 11 13 14 15 16 weak expression: see section 09
trochlear iv nerve
moderate moderate
regionalmoderate expression: see section 10 13
ventral grey horn
moderate moderate
regionalmoderate expression: see section 08 12 weak expression: see section 09 10 11
pons mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 16
oculomotor iii nerve
moderate moderate
regionalmoderate expression: see section 11 13
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2576
Entity Detected:Anks1, ( MGI:2446180)
Sequence:sense strand is shown

>T2576
AATTCGGACGAGGGCCACATGGAAGGCTCTGCCTTTGGCGCTTGTGTGAAACCAAGGCTGTGCCTGAACT
GTGAAGGAGCCGTTCTGGTGGGAATGGCAAGACGTGCCCAGTCCCTCATGCAGTGGCCACAGGATCCCTT
GCTTGCCTCTTGGCTGGCCTGCCGCCCTGCAGGCCCTGTGTCCCAGCAGGGGACTTTGGACTCTGAGGTT
GCCCACTGGGGGGTTCTGAGAAACCTTGGGTTTGAGCACTCAGAACACATGGCTGCAATCATCAAGACAG
TTCACAGTTAGCTTGTGAGGTGCCGGGACCAGCGCCGCAGGTCATGGGAGTTACTGCTCATGGTGGACAG
TGGGACTGGATTGTAAGAAAAATGTTATTTAATCTTTGTTTCCATATTTTGATACTTGAATTCCCCCTTT
TGTTTTACTGTACATAAAATTGTTAATCTGTCCGATTTTGTTTGAATTATAAACACCTTGTGGTACCAAA
CATAACCAACCTGTGCATCAGCATAGACCACCTCACTGCACAGTGTGCACCCCCTG
Notes:The probe template was PCR amplified from IMAGE:1383143 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1383143 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_005066 same experiment
 EMAGE:29738 same embryo
 EMAGE:30293 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS