Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31569

2900001O04Rik ( MGI:1914765)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31569 EMAGE:31569 EMAGE:31569 EMAGE:31569 EMAGE:31569
euxassay_001924_01 euxassay_001924_02 euxassay_001924_03 euxassay_001924_04 euxassay_001924_05
EMAGE:31569 EMAGE:31569 EMAGE:31569 EMAGE:31569 EMAGE:31569
euxassay_001924_06 euxassay_001924_07 euxassay_001924_08 euxassay_001924_09 euxassay_001924_10
EMAGE:31569 EMAGE:31569 EMAGE:31569 EMAGE:31569 EMAGE:31569
euxassay_001924_11 euxassay_001924_12 euxassay_001924_13 euxassay_001924_14 euxassay_001924_15
EMAGE:31569 EMAGE:31569 EMAGE:31569 EMAGE:31569 EMAGE:31569
euxassay_001924_16 euxassay_001924_17 euxassay_001924_18 euxassay_001924_19 euxassay_001924_20
EMAGE:31569 EMAGE:31569 EMAGE:31569 EMAGE:31569
euxassay_001924_21 euxassay_001924_22 euxassay_001924_23 euxassay_001924_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 15 weak expression: see section 05 06 07 08 11 16
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 17 18 19 20 21
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 13 14 16 17 weak expression: see section 12 18 19
spinal cord
moderate moderate
homogeneousmoderate expression: see section 05 06 07 08 09 10 11 12 13
brain
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 17
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T624
Entity Detected:2900001O04Rik, ( MGI:1914765)
Sequence:sense strand is shown

>T624
TCCTCNAGNCTGTTGGCCTACTGGGTTTTTCGGTAACTGGCTGCGGAATGGCTTCCTTTGGGTGGAAGAG
GAGAATTGGCGAGAAGGTATCCAAGGCCACGTCCCAGCAGTTTGAAGCAGAAGCAGCTGATGAGAAGGAT
GCAGCTGAGAACGAGGATGGGAACTGGCTTCAGGCCAGCAAACGGAGGAAGGAAACCCTGCAGGAGGGCT
GTAAACAGAGGAGCCAACAGCTGAAGGATGAAGGGGCTCAGCTGGCTGAAAACAAACGATACAAGGAGGC
AATTCAGAAGTGGGATGAAGCACTACAGCTAACCCCAGGTGATGCCACCCTTTATGAGATGAAATCACAG
GTCCTGCTGTCTCTTCATGAAATGTTTCCAGCAGTCCATGCAGCAGAGATGGCTGTCAAGCGTAACCCAC
ACTCGTGGGAGGCGTGGCAAACTTTAGGTCGAGCTCAGCTTGGATTAGGAGAGATAGTTCTGGCAATTCG
AAGCTTTCAAATAGCCCTGCACATATATCCGATGAACCCTGAACTCTGGAAGGAAGACC
Notes:The probe template was PCR amplified from IMAGE:1886246 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1886246 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_001924 same experiment
 EMAGE:29659 same embryo
 EMAGE:31487 same embryo
 EMAGE:30402 same embryo
 EMAGE:30455 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS