Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31577

2310007D09Rik ( MGI:1919128)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31577 EMAGE:31577 EMAGE:31577 EMAGE:31577 EMAGE:31577
euxassay_006378_01 euxassay_006378_02 euxassay_006378_03 euxassay_006378_04 euxassay_006378_05
EMAGE:31577 EMAGE:31577 EMAGE:31577 EMAGE:31577 EMAGE:31577
euxassay_006378_06 euxassay_006378_07 euxassay_006378_08 euxassay_006378_09 euxassay_006378_10
EMAGE:31577 EMAGE:31577 EMAGE:31577 EMAGE:31577 EMAGE:31577
euxassay_006378_11 euxassay_006378_12 euxassay_006378_13 euxassay_006378_14 euxassay_006378_15
EMAGE:31577 EMAGE:31577 EMAGE:31577 EMAGE:31577 EMAGE:31577
euxassay_006378_16 euxassay_006378_17 euxassay_006378_18 euxassay_006378_19 euxassay_006378_20
EMAGE:31577 EMAGE:31577 EMAGE:31577 EMAGE:31577
euxassay_006378_21 euxassay_006378_22 euxassay_006378_23 euxassay_006378_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18 19 weak expression: see section 03 04 05 06 07 08 20 21 22 23
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 weak expression: see section 06 07 08
nasal cavity olfactory epithelium
weak weak
spottedweak expression: see section 10 11 12 13 15 16 17 18 19 20 21
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35027
Entity Detected:2310007D09Rik, ( MGI:1919128)
Sequence:sense strand is shown

>T35027
TGACAGTTCGGACAATTACAGGAAATATCTACTATGCAAGGTCAGGAACAAAGGTTGTCGGGAAGGTTCA
TGAGAAGTTCACACTGATTGACGGAATCCGGGTGGCAACAGGCTCTTACAGTTTTACCTGGACCGACGGC
AAATTAAACAGCAGTAACTTGGTAATTCTGTCTGGCCAAGTGGTTGAACACTTTGATCTGGAGTTCCGGA
TCCTGTATGCTCAGTCAGAGCCCATCAGCTCCAAACTCCTGTCCAACTTCCAGATCAATAGCAAGTTTGA
CCATCTGGCTGACCGAAAGCCACAGTCGAAGGAGCCCACACTGGGCAATCTGCTGCGAATGAGGCTGGCC
AGGCTCTCAAGTACTCCCAGGAAGAGCAACCTGGGCCCAGAGGAGCCGCCAAAAGACAGAGCCAAACCCA
AGCGCCCTGACTCTGAGGCTTCTACCATCAGCGATGAAGACTATTTCCACAGCCACAAGGACCAGCTAGA
GGATAGTAAGGTGGCTGATGCTGCTACCCAAACAGAGCCCAGAGAAGAGATGGCTGCAGTAAGCCTGAGT
GAGGTGGGAACTCAGACTAGTTCCAGCATGATGTGTGTTGGGACCCAAACCACAGTTGTCACCAGGGCAG
CGAGCTCCCAGGCCACAGTGTGGTCCAAGTCCACTACCAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 76962. Forward Primer - name:076962_F_cDNA_2310007D09Rik, sequence:TGACAGTTCGGACAATTACAGG; Reverse Primer - name:076962_N_SP6_cDNA_2310007D09Rik, sequence:GTGGTAGTGGACTTGGACCAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_006378 same experiment
 EMAGE:30867 same embryo
 EMAGE:30470 same embryo
 EMAGE:29233 same embryo
 EMAGE:29211 same embryo
 EMAGE:29238 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS