Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31628

Rnasek ribonuclease, RNase K ( MGI:106369)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31628 EMAGE:31628 EMAGE:31628 EMAGE:31628 EMAGE:31628
euxassay_003050_01 euxassay_003050_02 euxassay_003050_03 euxassay_003050_04 euxassay_003050_05
EMAGE:31628 EMAGE:31628 EMAGE:31628 EMAGE:31628 EMAGE:31628
euxassay_003050_06 euxassay_003050_07 euxassay_003050_08 euxassay_003050_09 euxassay_003050_10
EMAGE:31628 EMAGE:31628 EMAGE:31628 EMAGE:31628 EMAGE:31628
euxassay_003050_11 euxassay_003050_12 euxassay_003050_13 euxassay_003050_14 euxassay_003050_15
EMAGE:31628 EMAGE:31628 EMAGE:31628 EMAGE:31628 EMAGE:31628
euxassay_003050_16 euxassay_003050_17 euxassay_003050_18 euxassay_003050_19 euxassay_003050_20
EMAGE:31628 EMAGE:31628 EMAGE:31628
euxassay_003050_21 euxassay_003050_22 euxassay_003050_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
strong strong
regionalstrong expression: see section 09 10 11 12 13 17 18 19
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 21 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 09 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 18 19 20 21 22 23
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 07 08 19 20
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 08 19 20
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T4842
Entity Detected:Rnasek, ribonuclease, RNase K ( MGI:106369)
Sequence:sense strand is shown

>T4842
TAGCATTTCCAGGGTTCCCTCTCCCGGCTTCTGTGCTCCGCTCAGTCTCCAGCGATCCCTCCCTACCTCC
GCCCTCCATGGCGTCGCTCCTGTGCTGTGGGCCTAAGCTGGCCGCCTGTGGCATCGTCCTCAGCGCCTGG
GGAGTGATCATGTTGATAATGCTCGGGATATTTTTCAATGTCCATTCTGCTGTGTTAATTGAGGACGTTC
CCTTCACAGAGAAAGATTTTGAGAACGGTCCTCAGAACATATACAACCTGTACGAGCAAGTCAGCTACAA
CTGTTTCATCGCCGCGGGCCTCTACCTCCTCCTCGGAGGCTTCTCCTTCTGCCAAGTTCGTCTCAACAAG
CGCAAGGAATACATGGTGCGCTAGAGCGCGGTCCGCCTCTCCCTCCCCAGCCCCCTTCTCTATTTAAAGA
CTCCGCAGACTCCGTCCCACTCATCTGGCGTCCTTTGGGACTTGTGACCCTAGCGAGACGTCATCCCTGG
CCCTGCAAAACTGCGCCCAGCCTCTGGAGGAGACCGAGGGTGACCGCGCCCCGTTCTGAACTACAATAAA
AAGAAGCGGTTCCCCCTAAAAAAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:5065541 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:5065541 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_003050 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS