Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31649

Olfr288 ( MGI:3030122)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31649 EMAGE:31649 EMAGE:31649 EMAGE:31649 EMAGE:31649
euxassay_005242_01 euxassay_005242_02 euxassay_005242_03 euxassay_005242_04 euxassay_005242_05
EMAGE:31649 EMAGE:31649 EMAGE:31649 EMAGE:31649 EMAGE:31649
euxassay_005242_06 euxassay_005242_07 euxassay_005242_08 euxassay_005242_09 euxassay_005242_10
EMAGE:31649 EMAGE:31649 EMAGE:31649 EMAGE:31649 EMAGE:31649
euxassay_005242_11 euxassay_005242_12 euxassay_005242_13 euxassay_005242_14 euxassay_005242_15
EMAGE:31649 EMAGE:31649 EMAGE:31649 EMAGE:31649 EMAGE:31649
euxassay_005242_16 euxassay_005242_17 euxassay_005242_18 euxassay_005242_19 euxassay_005242_20
EMAGE:31649 EMAGE:31649 EMAGE:31649
euxassay_005242_21 euxassay_005242_22 euxassay_005242_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
oral epithelium
strong strong
spottedstrong expression: see section 20
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 09
mandible
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 15 16 17 18 19 20
lung
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 14 15 17 18 21 22 moderate expression: see section 13 16 19 20
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T63
Entity Detected:Olfr288, ( MGI:3030122)
Sequence:sense strand is shown

>T63
CTGGGGAAACTTCTCCAGACACCCTCCTTCTGGGCAGATCCTGCCTAAGCCAGGCTGCCTCTCCCAAGAG
CCCGCCCCATGGCCCCCTTCATTTCCTTGTTGCGGAAGCTGTAGATGACCGGGTTGCACATGGGCATGAT
GATGGTATAGAGGAGGGAGAAAGACTTGTCTTTGTCAGGCCCATGTGTACTGCGGGGATTCATGTAAGAA
AACATGGCTGAAGTGTACAAAAAGATGACCACAGTCAGGTGGGAGGCACAAGTAGAAAAGGTCTTCCTAT
GGCTTGAGGAGGAGGCCCTGTGGAGGATGGAGGCCAGGATGCGGGCATAGGAGGTGATGATGAGCACCAT
GGGACTGAGCAACACCACAATGGCATCCACAAAGATCAACTTCATGGTGAACTTGAGGTCCCCGCAGGAG
AGAGCGATCACTATGGGAGCCTCACAGAAGAAGTTCTCTATGTGGTTGTCTTTGCAGAAGGGATTCCTGA
ATGATATATACTCAAGAAAGATACCATTGACC
Notes:The probe template was PCR amplified from IMAGE:1123486 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1123486 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_005242 same experiment
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS