Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31668

6030423D04Rik ( MGI:2441706)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31668 EMAGE:31668 EMAGE:31668 EMAGE:31668 EMAGE:31668
euxassay_009254_01 euxassay_009254_02 euxassay_009254_03 euxassay_009254_04 euxassay_009254_05
EMAGE:31668 EMAGE:31668 EMAGE:31668 EMAGE:31668 EMAGE:31668
euxassay_009254_06 euxassay_009254_07 euxassay_009254_08 euxassay_009254_09 euxassay_009254_10
EMAGE:31668 EMAGE:31668 EMAGE:31668 EMAGE:31668 EMAGE:31668
euxassay_009254_11 euxassay_009254_12 euxassay_009254_13 euxassay_009254_14 euxassay_009254_15
EMAGE:31668 EMAGE:31668 EMAGE:31668 EMAGE:31668 EMAGE:31668
euxassay_009254_16 euxassay_009254_17 euxassay_009254_18 euxassay_009254_19 euxassay_009254_20
EMAGE:31668 EMAGE:31668 EMAGE:31668 EMAGE:31668 EMAGE:31668
euxassay_009254_21 euxassay_009254_22 euxassay_009254_23 euxassay_009254_24 euxassay_009254_25
EMAGE:31668
euxassay_009254_26

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
diaphragm
strong strong
regionalstrong expression: see section 01 02 03 04 05 18 19 20 21 22 23 24 25 26 moderate expression: see section 06 07 08 09 10 11 17
foot
strong strong
regionalstrong expression: see section 22 23
leg muscle
strong strong
regionalstrong expression: see section 01 02 03 04 21 22 23 24
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26
thymus primordium
strong strong
regionalstrong expression: see section 11 12 13 14 15
arm muscle
strong strong
regionalstrong expression: see section 01 02 03 04 05 21 22 23 24 25 26
lower leg rest of mesenchyme
strong strong
regionalstrong expression: see section 26
extrinsic ocular muscle
strong strong
regionalstrong expression: see section 18 19 20 21 22 23
tongue
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17
forearm rest of mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 26
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T587
Entity Detected:6030423D04Rik, ( MGI:2441706)
Sequence:sense strand is shown

>T587
TCCTCGAGNCTGTTGGCCTACTGGACTTGCCGCCAGCCAGGGAAGGTGCTGAGGACCCAACACAAGGAAC
GGCTTCAGGGAGCTCGGCAGCTACAGTTCCTCAAAAGGAGAAACCTGGAAGAAGAGAAGAAAGGCCAAGC
CAGGGAACAAGGGCCCTCCAGCAAGACAGATGGAGGAACAGGCCAAGTGTCTATCCTCAAGGAGTCCTTG
CCTGGTGCCAACAAGGCCTCTTTCCCTGGACAGCAGGAAACAGGGATAAGCTCTGAGGTTTTCCCGGCCT
TACATCATTCCTCCTCAGGCATCCAGAGGGATCTGGGTGGCCACCATGCCTCCCATGGGAGAGCCTTTCC
ACCACAGGACTCTGACATCAAGAAGCCACACAGACAGCACCGGGGCACTCAGACAAAGGCAGAAGAGGCA
TTGCCAACAATAAAGAATGATGCCAGTCAGCAAACCAAATGTGGAGTTGCTGTCCTAGACAAGGACATCA
TTCAACTCTCGGAATACCTCAAAGAAGCCTTACATAGGGAGCTGATCCTAAAAAA
Notes:The probe template was PCR amplified from IMAGE:1885445 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1885445 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009254 same experiment
 EMAGE:31703 same embryo
 EMAGE:29651 same embryo
 EMAGE:29654 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS